BMRBj - BMREntryMaster

Found 1 Document (0.367 seconds)

BMRB: 11607

2RVO

Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish

Authors

Otsu, M., Norose, N., Arai, N., Terao, R., Kajikawa, M., Okada, N., Kawai, G.

Assembly

Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-1

Entity

1. Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-1 (polymer, Thiol state: not present), 34 monomers, 10922.47 Da Detail

GGCGCUUUGA CACAAUCUAC AUUGUAAAAG CGCC

Formula weight

10922.47 Da

Source organism

Danio rerio

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 24.6 %, Completeness (bb): 9.6 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	24.6 % (130 of 529)	32.6 % (97 of 298)	14.3 % (33 of 231)
Suger, PO4	9.6 % (36 of 374)	17.6 % (36 of 204)	0.0 % (0 of 170)
Nucleobase	60.6 % (94 of 155)	64.9 % (61 of 94)	54.1 % (33 of 61)
Aromatic	68.6 % (94 of 137)	80.3 % (61 of 76)	54.1 % (33 of 61)

1. RNA (34-MER)

GGCGCUUUGA CACAAUCUAC AUUGUAAAAG CGCC

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

Release date

2016-03-16

Citation

Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish
Otsu, M., Norose, N., Arai, N., Terao, R., Kajikawa, M., Okada, N., Kawai, G.
J. Biochem. (2017), PubMed 28431120 , DOI 10.1093/jb/mvx026 , Abstract

Experiments performed 7 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

3 2D 1H-13C HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

4 2D 1H-13C HSQC

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

5 2D 1H-13C HSQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
6	RNA (34-MER)	[U-13C; U-15N]-Ade	RNA	0.18 mM
7	RNA (34-MER)	[U-13C; U-15N]-Gua	RNA	0.19 mM
8	sodium phosphate	natural abundance	buffer	20 mM
9	sodium chloride	natural abundance	salt	50 mM
10	H2O	natural abundance	solvent	95 %
11	D2O	[U-2H]	solvent	5 %

6 2D 1H-13C TROSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

7 2D 1H-13C TROSY

Instrument

Bruker Avance - 600 MHz

Sample

State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 288 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (34-MER)	natural abundance	RNA	0.3 mM
2	RNA (34-MER)	[U-100% 13C; U-100% 15N]	RNA	0.26 mM
3	sodium phosphate	natural abundance	buffer	20 mM
4	sodium chloride	natural abundance	salt	50 mM
5	D2O	[U-2H]	solvent	100 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_11607_2rvo.nef
Input source #2: Coordindates	2rvo.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30----
GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC
||||||||||||||||||||||||||||||||||
GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	34	0	0	100.0

Content subtype: combined_11607_2rvo.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	130		100.0 (chain: A, length: 34)
1	Distance restraints	CNS/XPLOR_distance_constraints_6	OK	263 (1)	noe	100.0 (chain: A, length: 34)
2	Distance restraints	CNS/XPLOR_distance_constraints_7	OK	59 (1)	noe	55.9 (chain: A, length: 34)
3	Distance restraints	CNS/XPLOR_distance_constraints_8	Warning	36 (1)	noe	64.7 (chain: A, length: 34)
4	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	32 (1)	hbond	76.5 (chain: A, length: 34)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	294 (294)	.	94.1 (chain: A, length: 34)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	24 (24)	.	55.9 (chain: A, length: 34)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 97
  - ¹³C chemical shifts: 33
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	298	97	32.6
¹³C chemical shifts	231	33	14.3

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	204	36	17.6
¹³C chemical shifts	170	0	0.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	94	61	64.9
¹³C chemical shifts	61	33	54.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	27	27	100.0
¹³C chemical shifts	27	26	96.3

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_6
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 100.0%
- Total number of restraints: 263
- Weight of restraints: 1.0 (263)
- Potential type of restraints: square-well-parabolic (263)
- Range of distance target values: 2.83, 19.25 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_7
  - Status: OK
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 55.9%
  - Total number of restraints: 59
  - Weight of restraints: 1.0 (59)
  - Potential type of restraints: square-well-parabolic (59)
  - Range of distance target values: 2.18, 3.65 (Å)
  - Histogram of distance target values
  - Histogram of discrepancy in distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_8
    - Status: Warning
    - Experiment type: noe
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 64.7%
    - Total number of restraints: 36
    - Weight of restraints: 1.0 (36)
    - Potential type of restraints: square-well-parabolic (36)
    - Range of distance target values: 2.45, 2.95 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map
    - Saveframe: CNS/XPLOR_distance_constraints_2
      - Status: OK
      - Experiment type: hbond
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 76.5%
        --------10--------20--------30---- GGCGCUUUGACACAAUCUACAUUGUAAAAGCGCC |||||||| ||||| ||||| |||||||| GGCGCUUU...ACAAU....AUUGU.AAAGCGCC
      - Total number of restraints: 32
        Total hydrogen bond restraints: 32
        O...H-x: 1
        N...H-x: 1
        Long range: 30
        O...H-x: 18
        N...H-x: 12
      - Weight of restraints: 1.0 (32)
        Total hydrogen bond restraints: 1.0 (32)
        O...H-x: 1.0 (1)
        N...H-x: 1.0 (1)
        Long range: 1.0 (30)
        O...H-x: 1.0 (18)
        N...H-x: 1.0 (12)
      - Potential type of restraints: square-well-parabolic (32)
        Total hydrogen bond restraints: square-well-parabolic (32)
        O...H-x: square-well-parabolic (1)
        N...H-x: square-well-parabolic (1)
        Long range: square-well-parabolic (30)
        O...H-x: square-well-parabolic (18)
        N...H-x: square-well-parabolic (12)
      - Range of distance target values: 1.9, 1.9 (Å)
      - Distance restraints per residue
        Chain_ID: A
      - Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 94.1%
- Total number of restraints: 294
- Total number of restraints per polymer type: 294
- Weight of restraints: 1.0 (294)
- Potential type of restraints: square-well-parabolic (294)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 34, Sequence coverage: 55.9%
- Total number of restraints: 24
- Potential type of restraints: undefined (24)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords LINE, RNA, retrotransposon

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.367 seconds)

BMRB: 11607

Sample

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail