Solution Structure of the Frameshift-Inducing RNA Stem-Loop in SIV
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 67.5 % (366 of 542) | 74.6 % (223 of 299) | 59.8 % (137 of 229) | 42.9 % (6 of 14) |
Suger, PO4 | 58.3 % (218 of 374) | 67.2 % (137 of 204) | 47.6 % (81 of 170) | |
Nucleobase | 88.1 % (148 of 168) | 90.5 % (86 of 95) | 94.9 % (56 of 59) | 42.9 % (6 of 14) |
Aromatic | 91.8 % (134 of 146) | 98.6 % (72 of 73) | 94.9 % (56 of 59) | 42.9 % (6 of 14) |
1. SIV RNA (34-MER)
GGAUGGGGAA AGAAGCCCCG CAAUUUCCCC AUCCSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | 10 % |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
8 | H2O | natural abundance | 90 % | |
9 | D2O | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
10 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
11 | H2O | natural abundance | 90 % | |
12 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
10 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
11 | H2O | natural abundance | 90 % | |
12 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
10 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
11 | H2O | natural abundance | 90 % | |
12 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
10 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
11 | H2O | natural abundance | 90 % | |
12 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
10 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
11 | H2O | natural abundance | 90 % | |
12 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
8 | H2O | natural abundance | 90 % | |
9 | D2O | 10 % |
Bruker DMX - 750 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | SIV17-50 RNA (34-MER) | [U-100% 13C; U-100% 15N] | 1 mM | |
8 | H2O | natural abundance | 90 % | |
9 | D2O | 10 % |
Bruker DMX - 750 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 7.0
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | SIV17-50 RNA (34-MER) | natural abundance | 1 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | 10 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_15417_2jtp.nef |
Input source #2: Coordindates | 2jtp.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC |||||||||||||||||||||||||||||||||| GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 34 | 0 | 0 | 100.0 |
Content subtype: combined_15417_2jtp.nef
Assigned chemical shifts
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC |||||||||||||||||||||||||||||||||| GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
2 | G | H21 | 5.728 |
2 | G | H22 | 6.718 |
3 | A | H61 | 6.401 |
3 | A | H62 | 7.801 |
5 | G | H21 | 5.597 |
5 | G | H22 | 6.699 |
6 | G | H21 | 5.646 |
6 | G | H22 | 6.682 |
7 | G | H21 | 5.678 |
7 | G | H22 | 6.69 |
8 | G | H21 | 5.645 |
8 | G | H22 | 6.705 |
9 | A | H61 | 6.407 |
9 | A | H62 | 7.574 |
10 | A | H61 | 6.466 |
10 | A | H62 | 7.567 |
11 | A | H61 | 6.257 |
11 | A | H62 | 6.802 |
12 | G | H21 | 7.584 |
12 | G | H22 | 6.256 |
15 | G | H21 | 5.49 |
15 | G | H22 | 6.814 |
20 | G | H21 | 5.469 |
20 | G | H22 | 6.327 |
27 | C | N3 | 197.473 |
28 | C | N3 | 196.457 |
29 | C | N3 | 196.422 |
30 | C | N3 | 195.67 |
31 | A | H61 | 6.279 |
31 | A | H62 | 7.592 |
33 | C | N3 | 197.597 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 299 | 223 | 74.6 |
13C chemical shifts | 229 | 137 | 59.8 |
15N chemical shifts | 14 | 6 | 42.9 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 204 | 137 | 67.2 |
13C chemical shifts | 170 | 81 | 47.6 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 95 | 86 | 90.5 |
13C chemical shifts | 59 | 56 | 94.9 |
15N chemical shifts | 14 | 6 | 42.9 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 27 | 27 | 100.0 |
13C chemical shifts | 27 | 27 | 100.0 |
Distance restraints
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC ||||||||||| || || |||||||||||| .GAUGGGGAAAG..GC...GC.AUUUCCCCAUCC
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC |||||||||||| || || |||||||||||| GGAUGGGGAAAG..GC...GC.AUUUCCCCAUCC
Dihedral angle restraints
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC |||||||||||||||||||||||||||||||||| GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC
RDC restraints
--------10--------20--------30---- GGAUGGGGAAAGAAGCCCCGCAAUUUCCCCAUCC |||||| |||||| |||||| |||| GGAUGG..AAAGAA.......AAUUUC...AUCC