BMRBj - BMREntryMaster

Found 1 Document (0.393 seconds)

BMRB: 15538

2JWV

Structure of a high affinity anti-NFkB RNA aptamer

Authors

Reiter, N.J., Maher, L., Butcher, S.E.

Assembly

RNA apatamer

Entity

1. RNA apatamer (polymer, Thiol state: not present), 29 monomers, 9389.525 Da Detail

GAUACUUGAA ACUGUAAGGU UGGCGUAUC

Formula weight

9389.525 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 95.0 %, Completeness (bb): 97.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	95.0 % (438 of 461)	94.0 % (234 of 249)	98.5 % (192 of 195)	70.6 % (12 of 17)
Suger, PO4	97.2 % (310 of 319)	96.6 % (168 of 174)	97.9 % (142 of 145)
Nucleobase	90.1 % (128 of 142)	88.0 % (66 of 75)	100.0 % (50 of 50)	70.6 % (12 of 17)
Aromatic	92.5 % (124 of 134)	92.5 % (62 of 67)	100.0 % (50 of 50)	70.6 % (12 of 17)

1. RNA

GAUACUUGAA ACUGUAAGGU UGGCGUAUC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1 (±0.2) mM
2	KCl	natural abundance	50 mM
3	H20	natural abundance	90 %
4	D2O		10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
5	RNA	natural abundance		1 (±0.2) mM
6	D2O			100 %

Release date

2007-12-17

Citation

DNA mimicry by a high-affinity anti-NF-kappaB RNA aptamer
Reiter, N.J., Maher, L., Butcher, S.E.
Nucleic Acids Res. (2008), 36, 1227-1236, PubMed 18160411 , DOI 10.1093/nar/gkm1141 , Abstract

Related entities 1. RNA apatamer, : 1 : 1 entities Detail

Experiments performed 7 experiments Detail

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_15538_2jwv.nef
Input source #2: Coordindates	2jwv.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---------
GAUACUUGAAACUGUAAGGUUGGCGUAUC
|||||||||||||||||||||||||||||
GAUACUUGAAACUGUAAGGUUGGCGUAUC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	29	0	0	100.0

Content subtype: combined_15538_2jwv.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	480		100.0 (chain: A, length: 29)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	585 (1)	noe	100.0 (chain: A, length: 29)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	41 (1)	hbond	62.1 (chain: A, length: 29)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	179 (179)	.	89.7 (chain: A, length: 29)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	18 (18)	.	37.9 (chain: A, length: 29)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%

--------10--------20---------
GAUACUUGAAACUGUAAGGUUGGCGUAUC
|||||||||||||||||||||||||||||
GAUACUUGAAACUGUAAGGUUGGCGUAUC

Total number of assignments
- ¹H chemical shifts: 256
- ¹³C chemical shifts: 193
- ¹⁵N chemical shifts: 31

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	A	H62	8.065
2	A	H61	6.658
2	A	C5	66.277
2	A	N1	222.363
2	A	N6	82.552
4	A	H62	8.091
4	A	H61	6.897
4	A	N1	222.788
4	A	N6	82.238
5	C	N3	186.921
5	C	N4	96.098
9	A	H62	7.828
9	A	H61	6.64
9	A	N6	81.948
10	A	H62	7.991
10	A	H61	6.483
10	A	N1	222.646
11	A	H62	8.107
11	A	H61	6.779
11	A	N1	222.717
11	A	N6	82.003
12	C	N3	186.992
12	C	N4	96.115
14	G	H22	6.131
14	G	N2	76.85
18	G	H21	6.06
18	G	H22	6.08
19	G	H22	7.04
19	G	H21	6.539
19	G	N2	77.46
22	G	H22	6.996
22	G	H21	6.881
22	G	N2	77.697
23	G	H22	6.765
25	G	H22	7.721
25	G	H21	6.511
25	G	N2	70.806
27	A	H62	7.944
27	A	H61	6.293
27	A	N1	222.859
27	A	N6	82.943
29	C	N3	187.134

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	249	234	94.0
¹³C chemical shifts	195	192	98.5
¹⁵N chemical shifts	17	12	70.6

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	168	96.6
¹³C chemical shifts	145	142	97.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	75	66	88.0
¹³C chemical shifts	50	50	100.0
¹⁵N chemical shifts	17	12	70.6

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	24	24	100.0
¹³C chemical shifts	24	24	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
- Total number of restraints: 585
- Weight of restraints: 1.0 (585)
- Potential type of restraints: square-well-parabolic (585)
- Range of distance target values: 1.85, 6.4 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 62.1%
  - Total number of restraints: 41
  - Weight of restraints: 1.0 (41)
  - Potential type of restraints: square-well-parabolic (41)
  - Range of distance target values: 1.84, 3.7 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 89.7%
- Total number of restraints: 179
- Total number of restraints per polymer type: 179
- Weight of restraints: 1.0 (179)
- Potential type of restraints: square-well-parabolic (179)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 37.9%
- Total number of restraints: 18
- Potential type of restraints: square-well-parabolic (18)
- Range of observed RDC values: -19.8, 21.6 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue

Keywords NMR, RNA aptamer, RNA bending, Structure, transcription factor NF-kappa B, asymmetric internal bulge, RNA, stem loop

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.393 seconds)

BMRB: 15538

Sample #1

Sample #2

Related entities 1. RNA apatamer, : 1 : 1 entities Detail

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail