BMRBj - BMREntryMaster

Found 1 Document (0.446 seconds)

BMRB: 16941

2KX5

Recognition of HIV TAR RNA by peptide mimetic of Tat protein

Authors

Davidson, A., Patora-Komisarska, K., Robinson, J., Varani, G.

Assembly

47-MER

Entity

1. HIV-1 TAR/KP-Z-41 (polymer, Thiol state: not present), 29 monomers, 9370.525 Da Detail

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

2. peptide (polymer, Thiol state: all disulfide bound), 18 monomers, 2263.787 Da Detail

RVRCRQRKGR RICIRIXP

Total weight

11634.3125 Da

Max. entity weight

9370.525 Da

Entity Connection

disulfide 1 Detail

ID	Type	Value order	Atom ID 1	Atom ID 2
1	disulfide	sing	2:CYS4:SG	2:CYS13:SG

Source organism

Human immunodeficiency virus 1

Exptl. method

solution NMR

Refine. method

simulated annealing

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 93.6 %, Completeness: 60.9 %, Completeness (bb): 45.2 % Detail

Polymer type: polyribonucleotide polypeptide(L)

	Total	¹H
All	60.9 % (232 of 381)	60.9 % (232 of 381)
Backbone	45.2 % (94 of 208)	45.2 % (94 of 208)
Sidechain	79.8 % (138 of 173)	79.8 % (138 of 173)
Aromatic	82.8 % (53 of 64)	82.8 % (53 of 64)
Methyl	100.0 % (8 of 8)	100.0 % (8 of 8)

1. HIV-1 TAR/KP-Z-41

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

2. peptide

RVRCRQRKGR RICIRIXP

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
1	HIV-1 TAR/KP-Z-41	natural abundance		1 mM
2	D2O	natural abundance		100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Concentration
3	HIV-1 TAR/KP-Z-41	natural abundance	1 mM
4	H2O	natural abundance	90 %
5	D2O	natural abundance	10 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
8	HIV-1 TAR/KP-Z-41	[U-2H]		1 mM
9	D2O	natural abundance		100 %

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Concentration
10	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]	1 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

Protein Blocks Logo

Calculated from 10 models in PDB: 2KX5, Strand ID: B Detail

Release date

2010-08-23

Citation

Essential structural requirements for specific recognition of HIV TAR RNA by peptide mimetics of Tat protein
Davidson, A., Patora-Komisarska, K., Robinson, J.A., Varani, G.
Nucleic Acids Res. (2011), 39, 248-256, PubMed 20724442 , DOI 10.1093/nar/gkq713 , Abstract

Related entities 1. HIV-1 TAR/KP-Z-41, : 1 : 13 : 9 : 4 entities Detail

Related entities 2. peptide, : 1 entities Detail

Experiments performed 10 experiments Detail

1 2D 1H-1H TOCSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
1	HIV-1 TAR/KP-Z-41	natural abundance		1 mM
2	D2O	natural abundance		100 %

2 2D 1H-1H COSY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

3 2D 1H-1H NOESY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
1	HIV-1 TAR/KP-Z-41	natural abundance		1 mM
2	D2O	natural abundance		100 %

4 3D HCCH-TOCSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

5 3D 1H-13C NOESY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

6 2D 1H-1H NOESY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 6.6

#	Name	Isotope labeling	Concentration
3	HIV-1 TAR/KP-Z-41	natural abundance	1 mM
4	H2O	natural abundance	90 %
5	D2O	natural abundance	10 %

7 2D 1H-1H NOESY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
8	HIV-1 TAR/KP-Z-41	[U-2H]		1 mM
9	D2O	natural abundance		100 %

8 2D F1fF2f NOESY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

9 2D F1fF2f NOESY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 277 K, pH 6.6

#	Name	Isotope labeling	Concentration
10	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]	1 mM
11	H2O	natural abundance	90 %
12	D2O	natural abundance	10 %

10 2D F1fF2f TOCSY

Instrument

Bruker DMX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6

#	Name	Isotope labeling	Type	Concentration
6	HIV-1 TAR/KP-Z-41	[U-98% 13C; U-98% 15N]		1 mM
7	D2O	natural abundance		100 %

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_16941_2kx5.nef
Input source #2: Coordindates	2kx5.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	True (see coordinates for details)
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	True (see coordinates for details)
Overall data processing status	Warning

Disulfide bonds

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
B:4:CYS:SG	B:13:CYS:SG	unknown	unknown	2.019

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
2:17:DPR:C	2:18:PRO:N	unknown	unknown	n/a
2:16:ILE:C	2:17:DPR:N	unknown	unknown	n/a

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	17	DPR	D-PROLINE	Assigned chemical shifts, Coordinates

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--20--------30--------40-----
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
|||||||||||||||||||||||||||||
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
--------10--------20---------

Entity_assembly_ID (NMR): B vs Auth_asym_ID (model): B

--------10--------
RVRCRQRKGRRICIRIXP
||||||||||||||||||
RVRCRQRKGRRICIRIXP

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	29	0	0	100.0
B	B	18	0	0	100.0

Content subtype: combined_16941_2kx5.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	4		No information
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	259		93.1 (chain: A, length: 29), 100.0 (chain: B, length: 18)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	518 (1)	noe	100.0 (chain: A, length: 29), 88.9 (chain: B, length: 18)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	53 (1)	hbond	72.4 (chain: A, length: 29), 44.4 (chain: B, length: 18)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	190 (190)	.	75.9 (chain: A, length: 29), 88.9 (chain: B, length: 18)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 93.1%

--20--------30--------40-----
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
  |||||||||||||||||||||||||||
..CAGAUCUGAGCCUGGGAGCUCUCUGCC

Entity_assembly_ID: B, Chain length: 18, Sequence coverage: 100.0%

--------10--------
RVRCRQRKGRRICIRIXP
||||||||||||||||||
RVRCRQRKGRRICIRIXP

Total number of assignments
- ¹H chemical shifts: 259

Completeness of assignments

Entity_assemble_ID: A

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
20	A	H61	7.765
21	G	H21	7.304
22	A	H61	8.212
26	G	H21	8.204

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	256	114	44.5

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	61	35.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	82	53	64.6

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	18	16	88.9

Entity_assemble_ID: B

Excluded Comp_ID in statistics

Comp_index_ID	Comp_ID
17	DPR

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	ARG	HH11	7.449
1	ARG	HH12	7.449
1	ARG	HH21	6.974
1	ARG	HH22	6.974
3	ARG	HH11	7.369
3	ARG	HH12	7.369
8	LYS	HZ1	7.699
8	LYS	HZ2	7.699
8	LYS	HZ3	7.699
10	ARG	HH11	7.373
10	ARG	HH12	7.373
15	ARG	HH11	6.994
15	ARG	HH12	6.994
15	ARG	HH21	6.565
15	ARG	HH22	6.565

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	125	117	93.6

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	34	32	94.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	91	85	93.4

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	8	8	100.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Histogram of normalized assigned chemical shifts
Random coil index and derived parameters (S² and NMR RMSD)
- Chain_ID: B

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 18, Sequence coverage: 88.9%
- Total number of restraints: 517
- Weight of restraints: 1.0 (517)
- Potential type of restraints: square-well-parabolic (517)
- Range of distance target values: 2.5, 4.8 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 72.4%
    - Entity_assembly_ID: B, Chain length: 18, Sequence coverage: 44.4%
  - Total number of restraints: 53
  - Weight of restraints: 1.0 (53)
  - Potential type of restraints: square-well-parabolic (53)
  - Range of distance target values: 1.7, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 75.9%
  - Entity_assembly_ID: B, Chain length: 18, Sequence coverage: 88.9%
- Total number of restraints: 190
- Total number of restraints per polymer type: 190
- Weight of restraints: 1.0 (190)
- Potential type of restraints: square-well-parabolic (190)
- Plot of Phi-Psi angle restraints
- Dihedral angle restraints per residue
  - Chain_ID: A
  - Chain_ID: B

Keywords HIV-1 TAR, RNA recognition, Tat

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.446 seconds)

BMRB: 16941

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Related entities 1. HIV-1 TAR/KP-Z-41, : 1 : 13 : 9 : 4 entities Detail

Related entities 2. peptide, : 1 entities Detail

Experiments performed 10 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail