BMRBj - BMREntryMaster

Found 1 Document (0.446 seconds)

BMRB: 17083

2L1F

Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography

Authors

Summers, M.F., Irobalieva, R.N., Tolbert, B., Smalls-Manty, A., Iyalla, K., Loeliger, K., D'Souza, V., Khant, H., Schmid, M., Garcia, E., Telesnitsky, A., Chiu, W., Miyazaki, Y.

Assembly

65-MER

Entity

1. RNA (65-MER) (polymer, Thiol state: not present), 65 monomers, 21134.60 Da Detail

GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGG

2. RNA (66-MER) (polymer, Thiol state: not present), 66 monomers, 21479.81 Da Detail

GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGGG

Total weight

42614.41 Da

Max. entity weight

21479.81 Da

Source organism

Moloney murine leukemia virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 45.8 %, Completeness: 18.2 %, Completeness (bb): 15.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	18.2 % (208 of 1146)	18.2 % (208 of 1146)
Suger, PO4	15.0 % (118 of 786)	15.0 % (118 of 786)
Nucleobase	25.0 % (90 of 360)	25.0 % (90 of 360)
Aromatic	32.6 % (90 of 276)	32.6 % (90 of 276)

1. RNA (65-MER)

GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGG

2. RNA (66-MER)

GGCGGACCCG UGGUGGAACA GACGUGUUCG GAACACCCGG CCGCAACCCU GGGAGACGUC CCAGGG

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 7.0 (±0.1), Details A series of RNAs containing different isotopic labelings were used, as described in the associated paper.

#	Name	Isotope labeling	Type	Concentration
1	RNA (65-MER)	[U-2H]		400.0 ~ 800.0 (±100.0) uM
2	D2O	natural abundance		100 (±100.0) %

Release date

2010-10-13

Citation

Structure of a conserved retroviral RNA packaging element by NMR spectroscopy and cryo-electron tomography
Miyazaki, Y., Irobalieva, R.N., Tolbert, B.S., Smalls-Mantey, A., Iyalla, K., Loeliger, K., Khant, V., Schmid, H., Garcia, M.F., Telesnitsky, E.L., Chiu, A., Summers, W.
J. Mol. Biol. (2010), 404, 751-772, PubMed 20933521 , DOI 10.1016/j.jmb.2010.09.009 , Abstract

Related entities 1. RNA (65-MER), : 2 : 1 : 2 entities Detail

Related entities 2. RNA (66-MER), : 2 : 2 : 1 entities Detail

Experiments performed 2 experiments Detail

NMR combined restraints 44 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17083_2l1f.nef
Input source #2: Coordindates	2l1f.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Error

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--310-----320-------330-------340-------350-------360-------370---
GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG
 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
.GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG
0--------10--------20--------30--------40--------50--------60-----

Entity_assembly_ID (NMR): B vs Auth_asym_ID (model): B

-710-----720-------730-------740-------750-------760-------770--- 
GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG 
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGGG
--------10--------20--------30--------40--------50--------60------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
B	A	65	0	0	100.0
A	B	66	2	0	98.5

Content subtype: combined_17083_2l1f.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	208		90.8 (chain: B, length: 65)
1	Distance restraints	DYANA/DIANA_distance_constraints_36	Warning	10 (1)	undefined	12.1 (chain: A, length: 66)
2	Distance restraints	DYANA/DIANA_distance_constraints_27	OK	53 (1)	undefined	44.6 (chain: B, length: 65)
3	Distance restraints	DYANA/DIANA_distance_constraints_22	OK	6 (1)	undefined	No information
4	Distance restraints	DYANA/DIANA_distance_constraints_4	OK	237 (1)	noe	66.2 (chain: B, length: 65)
5	Distance restraints	DYANA/DIANA_distance_constraints_16	Error	115 (1)	noe	28.8 (chain: A, length: 66)
6	Distance restraints	DYANA/DIANA_distance_constraints_24	Warning	47 (1)	undefined	21.5 (chain: B, length: 65)
7	Distance restraints	DYANA/DIANA_distance_constraints_2	OK	138 (1)	undefined	70.8 (chain: B, length: 65)
8	Distance restraints	DYANA/DIANA_distance_constraints_8	OK	237 (1)	noe	65.2 (chain: A, length: 66)
9	Distance restraints	DYANA/DIANA_distance_constraints_34	Error	73 (1)	undefined	28.8 (chain: A, length: 66), 21.5 (chain: B, length: 65)
10	Distance restraints	DYANA/DIANA_distance_constraints_41	Warning	16 (1)	undefined	6.1 (chain: A, length: 66), 6.2 (chain: B, length: 65)
11	Distance restraints	DYANA/DIANA_distance_constraints_12	Warning	110 (1)	noe	29.2 (chain: B, length: 65)
12	Distance restraints	DYANA/DIANA_distance_constraints_21	Warning	24 (1)	noe	7.7 (chain: B, length: 65)
13	Distance restraints	DYANA/DIANA_distance_constraints_37	Error	16 (1)	undefined	22.7 (chain: A, length: 66)
14	Distance restraints	DYANA/DIANA_distance_constraints_25	OK	138 (1)	undefined	70.8 (chain: B, length: 65)
15	Distance restraints	DYANA/DIANA_distance_constraints_30	OK	53 (1)	undefined	43.9 (chain: A, length: 66)
16	Distance restraints	DYANA/DIANA_distance_constraints_20	OK	6 (1)	undefined	No information
17	Distance restraints	DYANA/DIANA_distance_constraints_19	OK	6 (1)	noe	No information
18	Distance restraints	DYANA/DIANA_distance_constraints_10	Warning	57 (1)	undefined	29.2 (chain: B, length: 65)
19	Distance restraints	DYANA/DIANA_distance_constraints_39	OK	4 (1)	undefined	No information
20	Distance restraints	DYANA/DIANA_distance_constraints_14	Error	60 (1)	undefined	28.8 (chain: A, length: 66)
21	Distance restraints	DYANA/DIANA_distance_constraints_23	Warning	24 (1)	noe	7.6 (chain: A, length: 66)
22	Distance restraints	DYANA/DIANA_distance_constraints_9	OK	44 (1)	undefined	42.4 (chain: A, length: 66)
23	Distance restraints	DYANA/DIANA_distance_constraints_17	Warning	10 (1)	undefined	12.1 (chain: A, length: 66)
24	Distance restraints	DYANA/DIANA_distance_constraints_31	Warning	86 (1)	undefined	45.5 (chain: A, length: 66), 29.2 (chain: B, length: 65)
25	Distance restraints	DYANA/DIANA_distance_constraints_5	OK	44 (1)	undefined	43.1 (chain: B, length: 65)
26	Distance restraints	DYANA/DIANA_distance_constraints_6	OK	138 (1)	undefined	69.7 (chain: A, length: 66)
27	Distance restraints	DYANA/DIANA_distance_constraints_33	Warning	10 (1)	undefined	12.3 (chain: B, length: 65)
28	Distance restraints	DYANA/DIANA_distance_constraints_28	OK	168 (1)	undefined	69.7 (chain: A, length: 66), 46.2 (chain: B, length: 65)
29	Distance restraints	DYANA/DIANA_distance_constraints_13	Warning	10 (1)	undefined	12.3 (chain: B, length: 65)
30	Distance restraints	DYANA/DIANA_distance_constraints_42	Warning	47 (1)	undefined	21.5 (chain: B, length: 65)
31	Distance restraints	DYANA/DIANA_distance_constraints_40	Warning	12 (1)	hbond	No information
32	Distance restraints	DYANA/DIANA_distance_constraints_7	Warning	88 (1)	hbond	48.5 (chain: A, length: 66)
33	Distance restraints	DYANA/DIANA_distance_constraints_11	Warning	38 (1)	hbond	21.5 (chain: B, length: 65)
34	Distance restraints	DYANA/DIANA_distance_constraints_38	Warning	12 (1)	hbond	No information
35	Distance restraints	DYANA/DIANA_distance_constraints_3	Warning	88 (1)	hbond	49.2 (chain: B, length: 65)
36	Distance restraints	DYANA/DIANA_distance_constraints_35	Error	44 (1)	hbond	22.7 (chain: A, length: 66)
37	Distance restraints	DYANA/DIANA_distance_constraints_32	Warning	38 (1)	hbond	21.5 (chain: B, length: 65)
38	Distance restraints	DYANA/DIANA_distance_constraints_26	Warning	88 (1)	hbond	49.2 (chain: B, length: 65)
39	Distance restraints	DYANA/DIANA_distance_constraints_15	Error	44 (1)	hbond	22.7 (chain: A, length: 66)
40	Distance restraints	DYANA/DIANA_distance_constraints_29	Warning	88 (1)	hbond	48.5 (chain: A, length: 66)
41	Distance restraints	DYANA/DIANA_distance_constraints_18	Warning	30 (1)	hbond	9.1 (chain: A, length: 66), 9.2 (chain: B, length: 65)
1	Dihedral angle restraints	DYANA/DIANA_dihedral_43	OK	618 (618)	.	100.0 (chain: A, length: 66), 100.0 (chain: B, length: 65)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 90.8%
- Total number of assignments
  - ¹H chemical shifts: 208
- Completeness of assignments
  - Entity_assemble_ID: B
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	569	205	36.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	390	116	29.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	179	89	49.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	50	50	100.0

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_36
- Status: Warning
- Experiment type: undefined
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 12.1%
- Total number of restraints: 10
- Weight of restraints: 1.0 (10)
- Potential type of restraints: lower-bound-parabolic (10)
- Range of distance target values: 10.5, 13.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map
- Saveframe: DYANA/DIANA_distance_constraints_27
  - Status: OK
  - Experiment type: undefined
  - Sequence coverage of experimental data
    - Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 44.6%
  - Total number of restraints: 53
  - Weight of restraints: 1.0 (53)
  - Potential type of restraints: lower-bound-parabolic (53)
  - Range of distance target values: 7.0, 16.1 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
      None
    - Chain_ID: B
  - Distance restraints on contact map
  - Saveframe: DYANA/DIANA_distance_constraints_22
    - Status: OK
    - Experiment type: undefined
    - Total number of restraints: 6
    - Weight of restraints: 1.0 (6)
    - Potential type of restraints: upper-bound-parabolic (6)
    - Range of distance target values: 1.46, 2.58 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
      - Chain_ID: B
        None
    - Distance restraints on contact map
    - Saveframe: DYANA/DIANA_distance_constraints_4
      - Status: OK
      - Experiment type: noe
      - Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 66.2%
        -710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||| .GCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGC -710-----720-------730-------740-------750--
      - Total number of restraints: 237
        Intra-residue restraints, i = j : 84
        Sequential restraints, | i - j | = 1 : 139
        Backbone-backbone: 1
        Backbone-side chain: 84
        Side chain-side chain: 54
        Medium range restraints, 1 < | i - j | < 5 : 7
        Backbone-side chain: 5
        Side chain-side chain: 2
        Long range restraints, | i - j | >= 5 : 7
      - Weight of restraints: 1.0 (237)
        Intra-residue restraints, i = j : 1.0 (84)
        Sequential restraints, | i - j | = 1 : 1.0 (139)
        Backbone-backbone: 1.0 (1)
        Backbone-side chain: 1.0 (84)
        Side chain-side chain: 1.0 (54)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (7)
        Backbone-side chain: 1.0 (5)
        Side chain-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (7)
      - Potential type of restraints: upper-bound-parabolic (237)
        Intra-residue restraints, i = j : upper-bound-parabolic (84)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (139)
        Backbone-backbone: upper-bound-parabolic (1)
        Backbone-side chain: upper-bound-parabolic (84)
        Side chain-side chain: upper-bound-parabolic (54)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (7)
        Backbone-side chain: upper-bound-parabolic (5)
        Side chain-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (7)
      - Range of distance target values: 2.7, 6.5 (Å)
      - Histogram of distance target values
      - Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
      - Distance restraints on contact map
        Chain_ID_1: B - Chain_ID_2: B
      - Saveframe: DYANA/DIANA_distance_constraints_16
        Status: Error
        Experiment type: noe
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 28.8%
        Total number of restraints: 115
        Intra-residue restraints, i = j : 40
        Sequential restraints, | i - j | = 1 : 66
        Backbone-backbone: 2
        Backbone-side chain: 37
        Side chain-side chain: 27
        Medium range restraints, 1 < | i - j | < 5 : 2
        Backbone-side chain: 2
        Long range restraints, | i - j | >= 5 : 7
        Weight of restraints: 1.0 (115)
        Intra-residue restraints, i = j : 1.0 (40)
        Sequential restraints, | i - j | = 1 : 1.0 (66)
        Backbone-backbone: 1.0 (2)
        Backbone-side chain: 1.0 (37)
        Side chain-side chain: 1.0 (27)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (2)
        Backbone-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (7)
        Potential type of restraints: upper-bound-parabolic (115)
        Intra-residue restraints, i = j : upper-bound-parabolic (40)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (66)
        Backbone-backbone: upper-bound-parabolic (2)
        Backbone-side chain: upper-bound-parabolic (37)
        Side chain-side chain: upper-bound-parabolic (27)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (2)
        Backbone-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (7)
        Range of distance target values: 2.7, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_24
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 21.5%
        Total number of restraints: 47
        Sequential restraints, | i - j | = 1 : 1
        Backbone-backbone: 1
        Medium range restraints, 1 < | i - j | < 5 : 2
        Backbone-backbone: 2
        Long range restraints, | i - j | >= 5 : 44
        Weight of restraints: 1.0 (47)
        Sequential restraints, | i - j | = 1 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (2)
        Backbone-backbone: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (44)
        Potential type of restraints: upper-bound-parabolic (47)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (1)
        Backbone-backbone: upper-bound-parabolic (1)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (2)
        Backbone-backbone: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (44)
        Range of distance target values: 12.0, 16.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_2
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 70.8%
        -710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||                    GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA -710-----720-------730-------740-------750----
        Total number of restraints: 138
        Intra-residue restraints, i = j : 138
        Weight of restraints: 1.0 (138)
        Intra-residue restraints, i = j : 1.0 (138)
        Potential type of restraints: upper-bound-parabolic (138)
        Intra-residue restraints, i = j : upper-bound-parabolic (138)
        Range of distance target values: 1.46, 2.58 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Chain_ID_1: B - Chain_ID_2: B
        Saveframe: DYANA/DIANA_distance_constraints_8
        Status: OK
        Experiment type: noe
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 65.2%
        --310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG   |||||||||||||||||||||||||||||||||||||||||||                      ..GCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGC --310-----320-------330-------340-------350--
        Total number of restraints: 237
        Intra-residue restraints, i = j : 84
        Sequential restraints, | i - j | = 1 : 139
        Backbone-backbone: 1
        Backbone-side chain: 84
        Side chain-side chain: 54
        Medium range restraints, 1 < | i - j | < 5 : 7
        Backbone-side chain: 5
        Side chain-side chain: 2
        Long range restraints, | i - j | >= 5 : 7
        Weight of restraints: 1.0 (237)
        Intra-residue restraints, i = j : 1.0 (84)
        Sequential restraints, | i - j | = 1 : 1.0 (139)
        Backbone-backbone: 1.0 (1)
        Backbone-side chain: 1.0 (84)
        Side chain-side chain: 1.0 (54)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (7)
        Backbone-side chain: 1.0 (5)
        Side chain-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (7)
        Potential type of restraints: upper-bound-parabolic (237)
        Intra-residue restraints, i = j : upper-bound-parabolic (84)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (139)
        Backbone-backbone: upper-bound-parabolic (1)
        Backbone-side chain: upper-bound-parabolic (84)
        Side chain-side chain: upper-bound-parabolic (54)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (7)
        Backbone-side chain: upper-bound-parabolic (5)
        Side chain-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (7)
        Range of distance target values: 2.7, 6.5 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
        Saveframe: DYANA/DIANA_distance_constraints_34
        Status: Error
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 28.8%
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 21.5%
        Total number of restraints: 73
        Intra-residue restraints, i = j : 59
        Long range restraints, | i - j | >= 5 : 14
        Weight of restraints: 1.0 (73)
        Intra-residue restraints, i = j : 1.0 (59)
        Long range restraints, | i - j | >= 5 : 1.0 (14)
        Potential type of restraints: upper-bound-parabolic (73)
        Intra-residue restraints, i = j : upper-bound-parabolic (59)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (14)
        Range of distance target values: 1.44, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_41
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 6.1%
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 6.2%
        Total number of restraints: 16
        Intra-residue restraints, i = j : 12
        Inter-chain restraints: 3
        Symmetric restraints: 1
        Weight of restraints: 1.0 (16)
        Intra-residue restraints, i = j : 1.0 (12)
        Inter-chain restraints: 1.0 (3)
        Symmetric restraints: 1.0 (1)
        Potential type of restraints: upper-bound-parabolic (16)
        Intra-residue restraints, i = j : upper-bound-parabolic (12)
        Inter-chain restraints: upper-bound-parabolic (3)
        Symmetric restraints: upper-bound-parabolic (1)
        Range of distance target values: 1.44, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_12
        Status: Warning
        Experiment type: noe
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 29.2%
        Total number of restraints: 110
        Intra-residue restraints, i = j : 38
        Sequential restraints, | i - j | = 1 : 66
        Backbone-backbone: 2
        Backbone-side chain: 37
        Side chain-side chain: 27
        Medium range restraints, 1 < | i - j | < 5 : 2
        Backbone-side chain: 2
        Long range restraints, | i - j | >= 5 : 4
        Weight of restraints: 1.0 (110)
        Intra-residue restraints, i = j : 1.0 (38)
        Sequential restraints, | i - j | = 1 : 1.0 (66)
        Backbone-backbone: 1.0 (2)
        Backbone-side chain: 1.0 (37)
        Side chain-side chain: 1.0 (27)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (2)
        Backbone-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (4)
        Potential type of restraints: upper-bound-parabolic (110)
        Intra-residue restraints, i = j : upper-bound-parabolic (38)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (66)
        Backbone-backbone: upper-bound-parabolic (2)
        Backbone-side chain: upper-bound-parabolic (37)
        Side chain-side chain: upper-bound-parabolic (27)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (2)
        Backbone-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (4)
        Range of distance target values: 2.7, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_21
        Status: Warning
        Experiment type: noe
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 7.7%
        Total number of restraints: 24
        Intra-residue restraints, i = j : 10
        Sequential restraints, | i - j | = 1 : 13
        Backbone-side chain: 8
        Side chain-side chain: 5
        Long range restraints, | i - j | >= 5 : 1
        Weight of restraints: 1.0 (24)
        Intra-residue restraints, i = j : 1.0 (10)
        Sequential restraints, | i - j | = 1 : 1.0 (13)
        Backbone-side chain: 1.0 (8)
        Side chain-side chain: 1.0 (5)
        Long range restraints, | i - j | >= 5 : 1.0 (1)
        Potential type of restraints: upper-bound-parabolic (24)
        Intra-residue restraints, i = j : upper-bound-parabolic (10)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (13)
        Backbone-side chain: upper-bound-parabolic (8)
        Side chain-side chain: upper-bound-parabolic (5)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (1)
        Range of distance target values: 2.7, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_37
        Status: Error
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 22.7%
        Total number of restraints: 16
        Sequential restraints, | i - j | = 1 : 2
        Side chain-side chain: 2
        Long range restraints, | i - j | >= 5 : 14
        Weight of restraints: 1.0 (16)
        Sequential restraints, | i - j | = 1 : 1.0 (2)
        Side chain-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (14)
        Potential type of restraints: upper-bound-parabolic (16)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (2)
        Side chain-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (14)
        Range of distance target values: 8.3, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_25
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 70.8%
        -710-----720-------730-------740-------750-------760-------770--- GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||                    GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA -710-----720-------730-------740-------750----
        Total number of restraints: 138
        Intra-residue restraints, i = j : 138
        Weight of restraints: 1.0 (138)
        Intra-residue restraints, i = j : 1.0 (138)
        Potential type of restraints: upper-bound-parabolic (138)
        Intra-residue restraints, i = j : upper-bound-parabolic (138)
        Range of distance target values: 1.44, 2.48 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Chain_ID_1: B - Chain_ID_2: B
        Saveframe: DYANA/DIANA_distance_constraints_30
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 43.9%
        Total number of restraints: 53
        Medium range restraints, 1 < | i - j | < 5 : 1
        Backbone-backbone: 1
        Long range restraints, | i - j | >= 5 : 52
        Weight of restraints: 1.0 (53)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Long range restraints, | i - j | >= 5 : 1.0 (52)
        Potential type of restraints: lower-bound-parabolic (53)
        Medium range restraints, 1 < | i - j | < 5 : lower-bound-parabolic (1)
        Backbone-backbone: lower-bound-parabolic (1)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (52)
        Range of distance target values: 7.0, 16.1 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_20
        Status: OK
        Experiment type: undefined
        Total number of restraints: 6
        Intra-residue restraints, i = j : 6
        Weight of restraints: 1.0 (6)
        Intra-residue restraints, i = j : 1.0 (6)
        Potential type of restraints: upper-bound-parabolic (6)
        Intra-residue restraints, i = j : upper-bound-parabolic (6)
        Range of distance target values: 1.46, 2.58 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_19
        Status: OK
        Experiment type: noe
        Total number of restraints: 6
        Inter-chain restraints: 3
        Symmetric restraints: 3
        Weight of restraints: 1.0 (6)
        Inter-chain restraints: 1.0 (3)
        Symmetric restraints: 1.0 (3)
        Potential type of restraints: upper-bound-parabolic (6)
        Inter-chain restraints: upper-bound-parabolic (3)
        Symmetric restraints: upper-bound-parabolic (3)
        Range of distance target values: 5.0, 5.0 (Å)
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_10
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 29.2%
        Total number of restraints: 57
        Intra-residue restraints, i = j : 57
        Weight of restraints: 1.0 (57)
        Intra-residue restraints, i = j : 1.0 (57)
        Potential type of restraints: upper-bound-parabolic (57)
        Intra-residue restraints, i = j : upper-bound-parabolic (57)
        Range of distance target values: 1.46, 2.58 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_39
        Status: OK
        Experiment type: undefined
        Total number of restraints: 4
        Inter-chain restraints: 3
        Symmetric restraints: 1
        Weight of restraints: 1.0 (4)
        Inter-chain restraints: 1.0 (3)
        Symmetric restraints: 1.0 (1)
        Potential type of restraints: upper-bound-parabolic (4)
        Inter-chain restraints: upper-bound-parabolic (3)
        Symmetric restraints: upper-bound-parabolic (1)
        Range of distance target values: 8.3, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_14
        Status: Error
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 28.8%
        Total number of restraints: 60
        Intra-residue restraints, i = j : 60
        Weight of restraints: 1.0 (60)
        Intra-residue restraints, i = j : 1.0 (60)
        Potential type of restraints: upper-bound-parabolic (60)
        Intra-residue restraints, i = j : upper-bound-parabolic (60)
        Range of distance target values: 1.46, 2.58 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_23
        Status: Warning
        Experiment type: noe
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 7.6%
        Total number of restraints: 24
        Intra-residue restraints, i = j : 10
        Sequential restraints, | i - j | = 1 : 13
        Backbone-side chain: 8
        Side chain-side chain: 5
        Long range restraints, | i - j | >= 5 : 1
        Weight of restraints: 1.0 (24)
        Intra-residue restraints, i = j : 1.0 (10)
        Sequential restraints, | i - j | = 1 : 1.0 (13)
        Backbone-side chain: 1.0 (8)
        Side chain-side chain: 1.0 (5)
        Long range restraints, | i - j | >= 5 : 1.0 (1)
        Potential type of restraints: upper-bound-parabolic (24)
        Intra-residue restraints, i = j : upper-bound-parabolic (10)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (13)
        Backbone-side chain: upper-bound-parabolic (8)
        Side chain-side chain: upper-bound-parabolic (5)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (1)
        Range of distance target values: 2.7, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_9
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 42.4%
        Total number of restraints: 44
        Medium range restraints, 1 < | i - j | < 5 : 1
        Backbone-backbone: 1
        Long range restraints, | i - j | >= 5 : 43
        Weight of restraints: 1.0 (44)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Long range restraints, | i - j | >= 5 : 1.0 (43)
        Potential type of restraints: upper-bound-parabolic (44)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (1)
        Backbone-backbone: upper-bound-parabolic (1)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (43)
        Range of distance target values: 9.0, 17.1 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_17
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 12.1%
        Total number of restraints: 10
        Long range restraints, | i - j | >= 5 : 10
        Weight of restraints: 1.0 (10)
        Long range restraints, | i - j | >= 5 : 1.0 (10)
        Potential type of restraints: lower-bound-parabolic (10)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (10)
        Range of distance target values: 11.5, 14.5 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_31
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 45.5%
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 29.2%
        Total number of restraints: 86
        Intra-residue restraints, i = j : 56
        Long range restraints, | i - j | >= 5 : 30
        Weight of restraints: 1.0 (86)
        Intra-residue restraints, i = j : 1.0 (56)
        Long range restraints, | i - j | >= 5 : 1.0 (30)
        Potential type of restraints: upper-bound-parabolic (86)
        Intra-residue restraints, i = j : upper-bound-parabolic (56)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (30)
        Range of distance target values: 1.44, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_5
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 43.1%
        Total number of restraints: 44
        Medium range restraints, 1 < | i - j | < 5 : 1
        Backbone-backbone: 1
        Long range restraints, | i - j | >= 5 : 43
        Weight of restraints: 1.0 (44)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Long range restraints, | i - j | >= 5 : 1.0 (43)
        Potential type of restraints: upper-bound-parabolic (44)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (1)
        Backbone-backbone: upper-bound-parabolic (1)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (43)
        Range of distance target values: 9.0, 17.1 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_6
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 69.7%
        --310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||                    .GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA --310-----320-------330-------340-------350----
        Total number of restraints: 138
        Intra-residue restraints, i = j : 138
        Weight of restraints: 1.0 (138)
        Intra-residue restraints, i = j : 1.0 (138)
        Potential type of restraints: upper-bound-parabolic (138)
        Intra-residue restraints, i = j : upper-bound-parabolic (138)
        Range of distance target values: 1.46, 2.58 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
        Saveframe: DYANA/DIANA_distance_constraints_33
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 12.3%
        Total number of restraints: 10
        Long range restraints, | i - j | >= 5 : 10
        Weight of restraints: 1.0 (10)
        Long range restraints, | i - j | >= 5 : 1.0 (10)
        Potential type of restraints: lower-bound-parabolic (10)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (10)
        Range of distance target values: 10.5, 13.5 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_28
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 69.7%
        --310-----320-------330-------340-------350-------360-------370--- GGGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAACCCUGGGAGACGUCCCAGG ||||||||||||||||||||||||||||||||||||||||||||||                    .GGCGGACCCGUGGUGGAACAGACGUGUUCGGAACACCCGGCCGCAA --310-----320-------330-------340-------350----
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 46.2%
        Total number of restraints: 168
        Intra-residue restraints, i = j : 138
        Long range restraints, | i - j | >= 5 : 30
        Weight of restraints: 1.0 (168)
        Intra-residue restraints, i = j : 1.0 (138)
        Long range restraints, | i - j | >= 5 : 1.0 (30)
        Potential type of restraints: upper-bound-parabolic (168)
        Intra-residue restraints, i = j : upper-bound-parabolic (138)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (30)
        Range of distance target values: 1.44, 10.75 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
        Saveframe: DYANA/DIANA_distance_constraints_13
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 12.3%
        Total number of restraints: 10
        Long range restraints, | i - j | >= 5 : 10
        Weight of restraints: 1.0 (10)
        Long range restraints, | i - j | >= 5 : 1.0 (10)
        Potential type of restraints: lower-bound-parabolic (10)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (10)
        Range of distance target values: 11.5, 14.5 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_42
        Status: Warning
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 21.5%
        Total number of restraints: 47
        Sequential restraints, | i - j | = 1 : 1
        Backbone-backbone: 1
        Medium range restraints, 1 < | i - j | < 5 : 2
        Backbone-backbone: 2
        Long range restraints, | i - j | >= 5 : 44
        Weight of restraints: 1.0 (47)
        Sequential restraints, | i - j | = 1 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (2)
        Backbone-backbone: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (44)
        Potential type of restraints: lower-bound-parabolic (47)
        Sequential restraints, | i - j | = 1 : lower-bound-parabolic (1)
        Backbone-backbone: lower-bound-parabolic (1)
        Medium range restraints, 1 < | i - j | < 5 : lower-bound-parabolic (2)
        Backbone-backbone: lower-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (44)
        Range of distance target values: 10.0, 12.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_40
        Status: Warning
        Experiment type: hbond
        Total number of restraints: 12
        Total hydrogen bond restraints: 12
        Weight of restraints: 1.0 (12)
        Total hydrogen bond restraints: 1.0 (12)
        Potential type of restraints: upper-bound-parabolic (12)
        Total hydrogen bond restraints: upper-bound-parabolic (12)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_7
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 48.5%
        Total number of restraints: 88
        Total hydrogen bond restraints: 88
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 84
        N...H-x (too close!): 15
        N...h_N: 15
        O...H-x (too close!): 27
        O...h-N: 27
        Weight of restraints: 1.0 (88)
        Total hydrogen bond restraints: 1.0 (88)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (84)
        N...H-x (too close!): 1.0 (15)
        N...h_N: 1.0 (15)
        O...H-x (too close!): 1.0 (27)
        O...h-N: 1.0 (27)
        Potential type of restraints: upper-bound-parabolic (88)
        Total hydrogen bond restraints: upper-bound-parabolic (88)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (84)
        N...H-x (too close!): upper-bound-parabolic (15)
        N...h_N: upper-bound-parabolic (15)
        O...H-x (too close!): upper-bound-parabolic (27)
        O...h-N: upper-bound-parabolic (27)
        Range of distance target values: 1.89, 3.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_11
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 21.5%
        Total number of restraints: 38
        Total hydrogen bond restraints: 38
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 34
        N...H-x (too close!): 6
        N...h_N: 6
        O...H-x (too close!): 11
        O...h-N: 11
        Weight of restraints: 1.0 (38)
        Total hydrogen bond restraints: 1.0 (38)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (34)
        N...H-x (too close!): 1.0 (6)
        N...h_N: 1.0 (6)
        O...H-x (too close!): 1.0 (11)
        O...h-N: 1.0 (11)
        Potential type of restraints: upper-bound-parabolic (38)
        Total hydrogen bond restraints: upper-bound-parabolic (38)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (34)
        N...H-x (too close!): upper-bound-parabolic (6)
        N...h_N: upper-bound-parabolic (6)
        O...H-x (too close!): upper-bound-parabolic (11)
        O...h-N: upper-bound-parabolic (11)
        Range of distance target values: 1.89, 3.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_38
        Status: Warning
        Experiment type: hbond
        Total number of restraints: 12
        Total hydrogen bond restraints: 12
        Weight of restraints: 1.0 (12)
        Total hydrogen bond restraints: 1.0 (12)
        Potential type of restraints: upper-bound-parabolic (12)
        Total hydrogen bond restraints: upper-bound-parabolic (12)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_3
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 49.2%
        Total number of restraints: 88
        Total hydrogen bond restraints: 88
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 84
        N...H-x (too close!): 15
        N...h_N: 15
        O...H-x (too close!): 27
        O...h-N: 27
        Weight of restraints: 1.0 (88)
        Total hydrogen bond restraints: 1.0 (88)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (84)
        N...H-x (too close!): 1.0 (15)
        N...h_N: 1.0 (15)
        O...H-x (too close!): 1.0 (27)
        O...h-N: 1.0 (27)
        Potential type of restraints: upper-bound-parabolic (88)
        Total hydrogen bond restraints: upper-bound-parabolic (88)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (84)
        N...H-x (too close!): upper-bound-parabolic (15)
        N...h_N: upper-bound-parabolic (15)
        O...H-x (too close!): upper-bound-parabolic (27)
        O...h-N: upper-bound-parabolic (27)
        Range of distance target values: 1.89, 3.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_35
        Status: Error
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 22.7%
        Total number of restraints: 44
        Total hydrogen bond restraints: 44
        N...H-x (too close!): 2
        N...h_N: 2
        O...H-x (too close!): 3
        O...h-N: 3
        Long range: 34
        N...H-x (too close!): 6
        N...h_N: 6
        O...H-x (too close!): 11
        O...h-N: 11
        Weight of restraints: 1.0 (44)
        Total hydrogen bond restraints: 1.0 (44)
        N...H-x (too close!): 1.0 (2)
        N...h_N: 1.0 (2)
        O...H-x (too close!): 1.0 (3)
        O...h-N: 1.0 (3)
        Long range: 1.0 (34)
        N...H-x (too close!): 1.0 (6)
        N...h_N: 1.0 (6)
        O...H-x (too close!): 1.0 (11)
        O...h-N: 1.0 (11)
        Potential type of restraints: upper-bound-parabolic (44)
        Total hydrogen bond restraints: upper-bound-parabolic (44)
        N...H-x (too close!): upper-bound-parabolic (2)
        N...h_N: upper-bound-parabolic (2)
        O...H-x (too close!): upper-bound-parabolic (3)
        O...h-N: upper-bound-parabolic (3)
        Long range: upper-bound-parabolic (34)
        N...H-x (too close!): upper-bound-parabolic (6)
        N...h_N: upper-bound-parabolic (6)
        O...H-x (too close!): upper-bound-parabolic (11)
        O...h-N: upper-bound-parabolic (11)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_32
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 21.5%
        Total number of restraints: 38
        Total hydrogen bond restraints: 38
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 34
        N...H-x (too close!): 6
        N...h_N: 6
        O...H-x (too close!): 11
        O...h-N: 11
        Weight of restraints: 1.0 (38)
        Total hydrogen bond restraints: 1.0 (38)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (34)
        N...H-x (too close!): 1.0 (6)
        N...h_N: 1.0 (6)
        O...H-x (too close!): 1.0 (11)
        O...h-N: 1.0 (11)
        Potential type of restraints: upper-bound-parabolic (38)
        Total hydrogen bond restraints: upper-bound-parabolic (38)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (34)
        N...H-x (too close!): upper-bound-parabolic (6)
        N...h_N: upper-bound-parabolic (6)
        O...H-x (too close!): upper-bound-parabolic (11)
        O...h-N: upper-bound-parabolic (11)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_26
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 49.2%
        Total number of restraints: 88
        Total hydrogen bond restraints: 88
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 84
        N...H-x (too close!): 15
        N...h_N: 15
        O...H-x (too close!): 27
        O...h-N: 27
        Weight of restraints: 1.0 (88)
        Total hydrogen bond restraints: 1.0 (88)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (84)
        N...H-x (too close!): 1.0 (15)
        N...h_N: 1.0 (15)
        O...H-x (too close!): 1.0 (27)
        O...h-N: 1.0 (27)
        Potential type of restraints: upper-bound-parabolic (88)
        Total hydrogen bond restraints: upper-bound-parabolic (88)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (84)
        N...H-x (too close!): upper-bound-parabolic (15)
        N...h_N: upper-bound-parabolic (15)
        O...H-x (too close!): upper-bound-parabolic (27)
        O...h-N: upper-bound-parabolic (27)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        None
        Chain_ID: B
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_15
        Status: Error
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 22.7%
        Total number of restraints: 44
        Total hydrogen bond restraints: 44
        N...H-x (too close!): 2
        N...h_N: 2
        O...H-x (too close!): 3
        O...h-N: 3
        Long range: 34
        N...H-x (too close!): 6
        N...h_N: 6
        O...H-x (too close!): 11
        O...h-N: 11
        Weight of restraints: 1.0 (44)
        Total hydrogen bond restraints: 1.0 (44)
        N...H-x (too close!): 1.0 (2)
        N...h_N: 1.0 (2)
        O...H-x (too close!): 1.0 (3)
        O...h-N: 1.0 (3)
        Long range: 1.0 (34)
        N...H-x (too close!): 1.0 (6)
        N...h_N: 1.0 (6)
        O...H-x (too close!): 1.0 (11)
        O...h-N: 1.0 (11)
        Potential type of restraints: upper-bound-parabolic (44)
        Total hydrogen bond restraints: upper-bound-parabolic (44)
        N...H-x (too close!): upper-bound-parabolic (2)
        N...h_N: upper-bound-parabolic (2)
        O...H-x (too close!): upper-bound-parabolic (3)
        O...h-N: upper-bound-parabolic (3)
        Long range: upper-bound-parabolic (34)
        N...H-x (too close!): upper-bound-parabolic (6)
        N...h_N: upper-bound-parabolic (6)
        O...H-x (too close!): upper-bound-parabolic (11)
        O...h-N: upper-bound-parabolic (11)
        Range of distance target values: 1.89, 3.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_29
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 48.5%
        Total number of restraints: 88
        Total hydrogen bond restraints: 88
        N...H-x (too close!): 1
        N...h_N: 1
        O...H-x (too close!): 1
        O...h-N: 1
        Long range: 84
        N...H-x (too close!): 15
        N...h_N: 15
        O...H-x (too close!): 27
        O...h-N: 27
        Weight of restraints: 1.0 (88)
        Total hydrogen bond restraints: 1.0 (88)
        N...H-x (too close!): 1.0 (1)
        N...h_N: 1.0 (1)
        O...H-x (too close!): 1.0 (1)
        O...h-N: 1.0 (1)
        Long range: 1.0 (84)
        N...H-x (too close!): 1.0 (15)
        N...h_N: 1.0 (15)
        O...H-x (too close!): 1.0 (27)
        O...h-N: 1.0 (27)
        Potential type of restraints: upper-bound-parabolic (88)
        Total hydrogen bond restraints: upper-bound-parabolic (88)
        N...H-x (too close!): upper-bound-parabolic (1)
        N...h_N: upper-bound-parabolic (1)
        O...H-x (too close!): upper-bound-parabolic (1)
        O...h-N: upper-bound-parabolic (1)
        Long range: upper-bound-parabolic (84)
        N...H-x (too close!): upper-bound-parabolic (15)
        N...h_N: upper-bound-parabolic (15)
        O...H-x (too close!): upper-bound-parabolic (27)
        O...h-N: upper-bound-parabolic (27)
        Range of distance target values: 1.8, 2.9 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_18
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 9.1%
        Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 9.2%
        Total number of restraints: 30
        Inter-chain restraints: 3
        Total hydrogen bond restraints: 24
        Symmetric restraints: 3
        Weight of restraints: 1.0 (30)
        Inter-chain restraints: 1.0 (3)
        Total hydrogen bond restraints: 1.0 (24)
        Symmetric restraints: 1.0 (3)
        Potential type of restraints: upper-bound-parabolic (30)
        Inter-chain restraints: upper-bound-parabolic (3)
        Total hydrogen bond restraints: upper-bound-parabolic (24)
        Symmetric restraints: upper-bound-parabolic (3)
        Range of distance target values: 1.89, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        Distance restraints on contact map

Dihedral angle restraints

Saveframe: DYANA/DIANA_dihedral_43
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 66, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 65, Sequence coverage: 100.0%
- Total number of restraints: 618
- Total number of restraints per polymer type: 618
- Weight of restraints: 1.0 (618)
- Potential type of restraints: square-well-parabolic (618)
- Dihedral angle restraints per residue
  - Chain_ID: A
  - Chain_ID: B

Keywords cryo-ET, NMR, packaging, retrovirus, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.446 seconds)

BMRB: 17083

Sample

Related entities 1. RNA (65-MER), : 2 : 1 : 2 entities Detail

Related entities 2. RNA (66-MER), : 2 : 2 : 1 entities Detail

Experiments performed 2 experiments Detail

Instrument

Sample

Instrument

Sample

NMR combined restraints 44 contents Detail