BMRBj - BMREntryMaster

Found 1 Document (0.335 seconds)

BMRB: 17106

2L1V

solution structure of a preQ1 riboswitch (Class I) aptamer bound to preQ1

Authors

Kang, M., Zhang, Q., Feigon, J.

Assembly

36-MER, 7-DEAZA-7-AMINOMETHYL-GUANINE

Entity

1. RNA (36-MER) (polymer, Thiol state: not present), 36 monomers, 11590.88 Da Detail

GGAGAGGUUC UAGUUAUACC CUCUAUAAAA AACUAA

2. PRF (non-polymer, Thiol state: not present), 179.179 Da

Total weight

11770.059 Da

Max. entity weight

11590.88 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 92.1 %, Completeness (bb): 93.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	92.1 % (527 of 572)	93.2 % (289 of 310)	93.1 % (229 of 246)	56.3 % (9 of 16)
Suger, PO4	93.7 % (371 of 396)	94.9 % (205 of 216)	92.2 % (166 of 180)
Nucleobase	88.6 % (156 of 176)	89.4 % (84 of 94)	95.5 % (63 of 66)	56.3 % (9 of 16)
Aromatic	89.0 % (146 of 164)	90.2 % (74 of 82)	95.5 % (63 of 66)	56.3 % (9 of 16)

1. RNA (36-MER)

GGAGAGGUUC UAGUUAUACC CUCUAUAAAA AACUAA

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
4	preQ1-RNA 36mer	natural abundance	1 mM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %
7	KCl	natural abundance	50 mM

Sample #3

Solvent system 90% H2O/10% D2O, phage, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	preQ1-RNA 36mer	[U-13C; U-15N]	0.7 mM
9	H2O	natural abundance	90 %
10	D2O	natural abundance	10 %
11	KCl	natural abundance	50 mM

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
12	preQ1-RNA 36mer	[U-13C; U-15N]-Ade	1 mM
13	D2O	natural abundance	100 %
14	KCl	natural abundance	50 mM

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
15	preQ1-RNA 36mer	[U-13C; U-15N]-Gua	1 mM
16	D2O	natural abundance	100 %
17	KCl	natural abundance	50 mM

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
18	preQ1-RNA 36mer	[U-13C; U-15N]-Ura	1 mM
19	D2O	natural abundance	100 %
20	KCl	natural abundance	50 mM

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
21	preQ1-RNA 36mer	U-H5,3',4',5',5''-2H	1 mM
22	D2O	natural abundance	100 %
23	KCl	natural abundance	50 mM

Release date

2010-08-18

Citation

Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of tRNA
Kang, M., Zhang, Q., Peterson, R.D., Feigon, J.
Mol. Cell (2009), 33, 784-790, PubMed 19285444 , DOI 10.1016/j.molcel.2009.02.019 , Abstract

Related entities 1. RNA (36-MER), : 1 : 2 entities Detail

Experiments performed 9 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

2 2D 1H-1H NOESY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
4	preQ1-RNA 36mer	natural abundance	1 mM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %
7	KCl	natural abundance	50 mM

3 2D 1H-1H TOCSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

4 3D HCCH-TOCSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

5 2D DQF-COSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

6 2D 1H-13C HSQC

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	preQ1-RNA 36mer	[U-13C; U-15N]-Cyt	1 mM
2	D2O	natural abundance	100 %
3	KCl	natural abundance	50 mM

7 2D 1H-15N COSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
4	preQ1-RNA 36mer	natural abundance	1 mM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %
7	KCl	natural abundance	50 mM

8 2D 1H-13C HSQC

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, phage, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	preQ1-RNA 36mer	[U-13C; U-15N]	0.7 mM
9	H2O	natural abundance	90 %
10	D2O	natural abundance	10 %
11	KCl	natural abundance	50 mM

9 2D 1H-15N HSQC

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, phage, Pressure 1 atm, Temperature 300 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	preQ1-RNA 36mer	[U-13C; U-15N]	0.7 mM
9	H2O	natural abundance	90 %
10	D2O	natural abundance	10 %
11	KCl	natural abundance	50 mM

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_17106_2l1v.nef
Input source #2: Coordindates	2l1v.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	PRF	7-DEAZA-7-AMINOMETHYL-GUANINE	Assigned chemical shifts, Distance restraints

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30------
GGAGAGGUUCUAGUUAUACCCUCUAUAAAAAACUAA
||||||||||||||||||||||||||||||||||||
GGAGAGGUUCUAGUUAUACCCUCUAUAAAAAACUAA

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	36	0	0	100.0

Content subtype: combined_17106_2l1v.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	615		100.0 (chain: A, length: 36), 100.0 (chain: B, length: 1)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	754 (1)	noe	100.0 (chain: A, length: 36), 100.0 (chain: B, length: 1)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	66 (1)	hbond	66.7 (chain: A, length: 36), 100.0 (chain: B, length: 1)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	154 (154)	.	100.0 (chain: A, length: 36)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_7	OK	76 (76)	.	80.6 (chain: A, length: 36)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 319
- ¹³C chemical shifts: 229
- ¹⁵N chemical shifts: 67

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
3	A	H61	7.42
3	A	N1	221.8
3	A	N3	216.3
3	A	N6	81.5
3	A	N7	230.5
4	G	H21	7.69
4	G	H22	5.64
4	G	N2	75.53
5	A	H61	6.75
5	A	N1	221.8
5	A	N3	216.3
5	A	N6	82.21
5	A	N7	230.0
6	G	H21	8.13
6	G	H22	6.14
6	G	N2	74.74
7	G	H21	8.76
7	G	H22	7.45
7	G	N2	81.06
12	A	N1	218.7
12	A	N3	211.3
12	A	N6	85.86
12	A	N7	233.1
13	G	H21	8.12
13	G	H22	7.71
13	G	N2	78.35
16	A	H61	7.1
16	A	N1	223.0
16	A	N3	213.6
16	A	N6	79.64
16	A	N7	235.4
18	A	H61	9.37
18	A	N1	228.9
18	A	N3	212.9
18	A	N6	87.3
18	A	N7	226.3
19	C	N4	95.89
20	C	N3	199.2
20	C	N4	94.8
21	C	N3	197.1
21	C	N4	96.81
23	C	N3	198.0
23	C	N4	97.52
25	A	H61	7.47
25	A	N1	226.4
25	A	N3	217.7
25	A	N6	80.25
25	A	N7	237.1
27	A	H61	7.58
27	A	N1	223.1
27	A	N3	211.7
27	A	N6	86.02
27	A	N7	229.5
28	A	H61	6.6
28	A	N6	80.54
29	A	H61	8.41
29	A	N1	220.5
29	A	N3	217.8
29	A	N6	79.7
30	A	H61	8.53
30	A	H62	6.54
30	A	N1	228.1
30	A	N3	216.4
30	A	N6	83.53
30	A	N7	229.8
31	A	H61	7.8
31	A	H62	7.45
31	A	N3	221.4
31	A	N6	87.6
32	A	H61	10.06
32	A	H62	8.07
32	A	N1	229.4
32	A	N3	208.3
32	A	N6	97.01
33	C	N3	199.9
33	C	N4	104.5
35	A	N1	222.0
35	A	N3	212.2
36	A	N1	226.3
36	A	N3	215.5

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	310	289	93.2
¹³C chemical shifts	246	229	93.1
¹⁵N chemical shifts	16	9	56.2

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	216	205	94.9
¹³C chemical shifts	180	166	92.2

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	94	84	89.4
¹³C chemical shifts	66	63	95.5
¹⁵N chemical shifts	16	9	56.2

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	34	32	94.1
¹³C chemical shifts	34	31	91.2

Entity_assemble_ID: B

Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID
1	PRF

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
- Total number of restraints: 754
- Weight of restraints: 1.0 (754)
- Potential type of restraints: square-well-parabolic (754)
- Range of distance target values: 2.25, 6.0 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 66.7%
    - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
  - Total number of restraints: 66
  - Weight of restraints: 1.0 (66)
  - Potential type of restraints: square-well-parabolic (66)
  - Range of distance target values: 2.0, 3.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Total number of restraints: 154
- Total number of restraints per polymer type: 154
- Weight of restraints: 1.0 (154)
- Potential type of restraints: square-well-parabolic (154)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_7
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 80.6%
- Total number of restraints: 76
- Potential type of restraints: square-well-parabolic (76)
- Range of observed RDC values: -27.28, 29.5 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords aptamer, preQ1, pseudoknot, riboswitch, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.335 seconds)

BMRB: 17106

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Related entities 1. RNA (36-MER), : 1 : 2 entities Detail

Experiments performed 9 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail