Solution structure of P2a-J2a/b-P2b of human telomerase RNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 97.7 % (552 of 565) | 96.8 % (302 of 312) | 100.0 % (235 of 235) | 83.3 % (15 of 18) |
Suger, PO4 | 100.0 % (385 of 385) | 100.0 % (210 of 210) | 100.0 % (175 of 175) | |
Nucleobase | 92.8 % (167 of 180) | 90.2 % (92 of 102) | 100.0 % (60 of 60) | 83.3 % (15 of 18) |
Aromatic | 95.5 % (149 of 156) | 94.9 % (74 of 78) | 100.0 % (60 of 60) | 83.3 % (15 of 18) |
1. RNA 35-MER
GGCUUUUGCU CCCCGUGCUU CGGCACGGAA AAGCCSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA_35-MER | natural abundance | 1.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
15 | P2ab RNA (35-MER) | natural abundance | 1.0 mM | |
16 | D2O | natural abundance | 100 % |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
17 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
18 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA_35-MER | natural abundance | 1.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA_35-MER | natural abundance | 1.0 mM | |
2 | H2O | natural abundance | 90 % | |
3 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
15 | P2ab RNA (35-MER) | natural abundance | 1.0 mM | |
16 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
15 | P2ab RNA (35-MER) | natural abundance | 1.0 mM | |
16 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
17 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
18 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | P2ab RNA (35-MER) | [U-98% 13C; U-98% 15N] | 1.0 mM | |
5 | H2O | natural abundance | 90 % | |
6 | D2O | natural abundance | 10 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
7 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ade | 1.0 mM | |
8 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
9 | P2ab RNA (35-MER) | [U-13C; U-15N]-Cyt | 1.0 mM | |
10 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
11 | P2ab RNA (35-MER) | [U-13C; U-15N]-Gua | 1.0 mM | |
12 | D2O | natural abundance | 100 % |
Bruker DRX - 500 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293.15 K, pH 6.4
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
13 | P2ab RNA (35-MER) | [U-13C; U-15N]-Ura | 1.0 mM | |
14 | D2O | natural abundance | 100 % |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_17188_2l3e.nef |
Input source #2: Coordindates | 2l3e.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--------30----- GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC ||||||||||||||||||||||||||||||||||| GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 35 | 0 | 0 | 100.0 |
Content subtype: combined_17188_2l3e.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | N9 | 168.447 |
2 | G | N9 | 169.341 |
3 | C | N1 | 151.067 |
3 | C | N4 | 99.006 |
4 | U | N1 | 154.289 |
5 | U | N1 | 154.534 |
6 | U | N1 | 154.644 |
7 | U | N1 | 153.608 |
8 | G | N9 | 169.023 |
9 | C | N1 | 151.941 |
10 | U | N1 | 152.386 |
11 | C | N1 | 151.935 |
12 | C | N1 | 152.285 |
13 | C | N1 | 152.242 |
13 | C | N4 | 98.654 |
14 | C | N1 | 150.709 |
14 | C | N4 | 98.342 |
15 | G | H21 | 8.269 |
15 | G | H22 | 6.958 |
15 | G | N9 | 169.095 |
16 | U | N1 | 153.709 |
17 | G | N9 | 169.785 |
18 | C | N1 | 151.217 |
18 | C | N4 | 99.761 |
19 | U | N1 | 154.876 |
20 | U | N1 | 151.877 |
21 | C | N1 | 150.611 |
21 | C | N4 | 93.902 |
22 | G | H22 | 6.665 |
22 | G | N9 | 171.718 |
23 | G | H21 | 8.792 |
23 | G | H22 | 6.426 |
23 | G | N2 | 75.818 |
23 | G | N9 | 170.408 |
24 | C | N1 | 151.182 |
24 | C | N4 | 97.928 |
25 | A | N9 | 170.864 |
26 | C | N1 | 150.404 |
26 | C | N4 | 98.492 |
27 | G | N9 | 168.71 |
28 | G | N9 | 168.565 |
29 | A | H61 | 7.718 |
29 | A | H62 | 6.586 |
29 | A | N6 | 83.625 |
29 | A | N9 | 169.136 |
30 | A | N9 | 170.016 |
31 | A | N9 | 170.31 |
32 | A | N9 | 170.362 |
33 | G | N9 | 169.032 |
34 | C | N1 | 151.227 |
34 | C | N4 | 99.458 |
35 | C | N1 | 152.612 |
35 | C | N4 | 97.691 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 312 | 302 | 96.8 |
13C chemical shifts | 235 | 235 | 100.0 |
15N chemical shifts | 18 | 15 | 83.3 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 210 | 210 | 100.0 |
13C chemical shifts | 175 | 175 | 100.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 102 | 92 | 90.2 |
13C chemical shifts | 60 | 60 | 100.0 |
15N chemical shifts | 18 | 15 | 83.3 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 20 | 20 | 100.0 |
13C chemical shifts | 20 | 20 | 100.0 |
Distance restraints
--------10--------20--------30----- GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC ||||||||||||||||||||||||||||||||||| GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC
Dihedral angle restraints
--------10--------20--------30----- GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC ||||||||||||||||||||||||||||||||||| GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC
RDC restraints
--------10--------20--------30----- GGCUUUUGCUCCCCGUGCUUCGGCACGGAAAAGCC || ||||| ||||||||||||||||||||||| GG.UUUUG....CCGUGCUUCGGCACGGAAAAGCC