BMRBj - BMREntryMaster

Found 1 Document (0.365 seconds)

BMRB: 17397

2L88

Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence

Authors

Tong, X., Cao, C.

Assembly

RET oncogene

Entity

1. RET oncogene (polymer), 20 monomers, 6457.045 Da Detail

GGGGCGGGGC GGGGCGGGGT

Formula weight

6457.045 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 95.7 %, Completeness (bb): 100.0 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	95.7 % (179 of 187)	95.7 % (179 of 187)
Suger, PO4	100.0 % (140 of 140)	100.0 % (140 of 140)
Nucleobase	83.0 % (39 of 47)	83.0 % (39 of 47)
Aromatic	90.0 % (36 of 40)	90.0 % (36 of 40)
Methyl	100.0 % (1 of 1)	100.0 % (1 of 1)

1. RET oncogene

GGGGCGGGGC GGGGCGGGGT

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RET_oncogene	natural abundance	0.2 ~ 3.0 mM
2	potassium phosphate	natural abundance	0.2 ~ 0.3 mM
3	H2O	natural abundance	90 %
4	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	RET_oncogene	natural abundance	0.2 ~ 3.0 mM
6	potassium phosphate	natural abundance	0.2 ~ 0.3 mM
7	D2O	natural abundance	100 %

Release date

2011-05-11

Citation

Solution structure of all parallel G-quadruplex formed by the oncogene RET promoter sequence
Tong, X., Lan, W., Zhang, X., Wu, H., Liu, M., Cao, C.
Nucleic Acids Res. (2011), 39, 6753-6763, PubMed 21540209 , DOI 10.1093/nar/gkr233 , Abstract

Experiments performed 4 experiments Detail

NMR combined restraints 3 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_17397_2l88.nef
Input source #2: Coordindates	2l88.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20
GGGGCGGGGCGGGGCGGGGT
||||||||||||||||||||
GGGGCGGGGCGGGGCGGGGT

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	20	0	0	100.0

Content subtype: combined_17397_2l88.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	RET_chemical_shifts	Warning	207		100.0 (chain: A, length: 20)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	369 (1)	noe	100.0 (chain: A, length: 20)

Assigned chemical shifts

Saveframe: RET_chemical_shifts

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 20, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 207

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DG	H21	5.34
1	DG	H22	8.45
2	DG	H21	6.22
2	DG	H22	9.38
3	DG	H21	6.3
3	DG	H22	9.22
4	DG	H21	5.44
4	DG	H22	5.44
7	DG	H21	6.47
7	DG	H22	9.4
8	DG	H21	6.65
8	DG	H22	9.33
9	DG	H21	6.1
9	DG	H22	9.01
11	DG	H21	6.32
11	DG	H22	9.41
12	DG	H21	6.06
12	DG	H22	10.1
13	DG	H21	6.14
13	DG	H22	8.42
14	DG	H21	5.39
14	DG	H22	5.39
17	DG	H21	6.23
17	DG	H22	9.34
18	DG	H21	6.11
18	DG	H22	9.98
19	DG	H21	6.3
19	DG	H22	8.48

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	187	179	95.7

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	140	140	100.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	47	39	83.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	1	1	100.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	16	16	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 20, Sequence coverage: 100.0%
- Total number of restraints: 369
- Weight of restraints: 1.0 (369)
- Potential type of restraints: square-well-parabolic (369)
- Range of distance target values: 2.5, 6.0 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map

Keywords G-quadruplex, NMR, RET

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.365 seconds)

BMRB: 17397

Sample #1

Sample #2

Experiments performed 4 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 3 contents Detail