BMRBj - BMREntryMaster

Found 1 Document (0.337 seconds)

BMRB: 17408

2L8H

Chemical probe bound to HIV TAR RNA

Authors

Davidson, A., Begley, D., Lau, C., Varani, G.

Assembly

HIV TAR RNA

Entity

1. HIV TAR RNA (polymer, Thiol state: not present), 29 monomers, 9370.525 Da Detail

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

2. ARG (non-polymer), 1 monomers, 174.2011 Da
3. L8H (non-polymer), 173.211 Da

Total weight

9717.9375 Da

Max. entity weight

9370.525 Da

Source organism

Human immunodeficiency virus 1

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 67.2 %, Completeness (bb): 59.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	67.2 % (172 of 256)	67.2 % (172 of 256)
Suger, PO4	59.2 % (103 of 174)	59.2 % (103 of 174)
Nucleobase	84.1 % (69 of 82)	84.1 % (69 of 82)
Aromatic	85.9 % (55 of 64)	85.9 % (55 of 64)

1. HIV TAR RNA

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Show sample condition

Sample #1

Solvent system 99.99% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 10 mM phosphate buffer, 99.99% D2O

#	Name	Isotope labeling	Concentration
1	HIV TAR RNA	natural abundance	1 mM
2	ARGININE	natural abundance	4 mM
3	4-METHOXYNAPHTHALEN-2-AMINE	natural abundance	4 mM
4	potassium phosphate	natural abundance	10 mM

Sample #2

Solvent system 90% H2O, 10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 10 mM phosphate buffer, 90% H2O, 10% D2O

#	Name	Isotope labeling	Concentration
5	HIV TAR RNA	natural abundance	1 mM
6	ARGININE	natural abundance	4 mM
7	4-METHOXYNAPHTHALEN-2-AMINE	natural abundance	4 mM
8	potassium phosphate	natural abundance	10 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 10 mM phosphate buffer, 99.99% D2O

#	Name	Isotope labeling	Concentration
9	HIV TAR RNA	[U-100% 13C; U-100% 15N]	1 mM
10	ARGININE	natural abundance	4 mM
11	4-METHOXYNAPHTHALEN-2-AMINE	natural abundance	4 mM
12	potassium phosphate	natural abundance	10 mM

Release date

2012-08-13

Citation

A small-molecule probe induces a conformation in HIV TAR RNA capable of binding drug-like fragments
Davidson, A., Begley, D., Lau, C., Varani, G.
J. Mol. Biol. (2011), 410, 984-996, PubMed 21763501 , DOI 10.1016/j.jmb.2011.03.039 , Abstract

Related entities 1. HIV TAR RNA, : 1 : 13 : 9 : 4 entities Detail

Experiments performed 5 experiments Detail

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_17408_2l8h.nef
Input source #2: Coordindates	2l8h.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
2:1:ARG:C	3:1:L8H:N	unknown	unknown	n/a

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	L8H	4-methoxynaphthalen-2-amine	Distance restraints

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--20--------30--------40-----
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
|||||||||||||||||||||||||||||
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
--------10--------20---------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	29	0	0	100.0

Content subtype: combined_17408_2l8h.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	1		No information
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	177		100.0 (chain: A, length: 29)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	249 (1)	noe	100.0 (chain: A, length: 29), 100.0 (chain: B, length: 1), 100.0 (chain: C, length: 1)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	54 (1)	hbond	65.5 (chain: A, length: 29)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	166 (166)	.	75.9 (chain: A, length: 29)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_6	OK	28 (28)	.	69.0 (chain: A, length: 29)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 177
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
27	A	H62	8.432
27	A	H61	7.986
28	G	H21	7.049
28	G	H22	9.055
43	G	H22	8.374

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	256	172	67.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	103	59.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	82	69	84.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	18	17	94.4

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
  - Entity_assembly_ID: C, Chain length: 1, Sequence coverage: 100.0%
- Total number of restraints: 249
- Weight of restraints: 1.0 (249)
- Potential type of restraints: square-well-parabolic (249)
- Range of distance target values: 2.5, 5.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
  - Chain_ID: C
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 65.5%
  - Total number of restraints: 54
  - Weight of restraints: 1.0 (54)
  - Potential type of restraints: square-well-parabolic (54)
  - Range of distance target values: 1.7, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
      None
    - Chain_ID: C
      None
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 75.9%
- Total number of restraints: 166
- Total number of restraints per polymer type: 166
- Weight of restraints: 1.0 (166)
- Potential type of restraints: square-well-parabolic (166)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_6
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 69.0%
- Total number of restraints: 28
- Potential type of restraints: undefined (28)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords arginine, fragment, HIV, RNA, TAR

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.337 seconds)

BMRB: 17408

Sample #1

Sample #2

Sample #3

Related entities 1. HIV TAR RNA, : 1 : 13 : 9 : 4 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail