BMRBj - BMREntryMaster

Found 1 Document (0.468 seconds)

BMRB: 17436

2L94

Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication

Authors

Marcheschi, R.J., Tonelli, M., Kumar, A., Butcher, S.E.

Assembly

45-MER

Entity

1. RNA (45-MER) (polymer, Thiol state: not present), 45 monomers, 14582.68 Da Detail

GGGAAGAUCU GGCCUUCCCA CAAGGGAAGG CCAGGGAAUC UUCCC

2. L94 (non-polymer, Thiol state: not present), 336.519 Da

Total weight

14919.198 Da

Max. entity weight

14582.68 Da

Source organism

Human immunodeficiency virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 53.2 %, Completeness (bb): 42.8 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	53.2 % (369 of 694)	78.1 % (307 of 393)	20.6 % (62 of 301)
Suger, PO4	42.8 % (212 of 495)	69.6 % (188 of 270)	10.7 % (24 of 225)
Nucleobase	78.9 % (157 of 199)	96.7 % (119 of 123)	50.0 % (38 of 76)
Aromatic	77.5 % (134 of 173)	99.0 % (96 of 97)	50.0 % (38 of 76)

1. RNA (45-MER)

GGGAAGAUCU GGCCUUCCCA CAAGGGAAGG CCAGGGAAUC UUCCC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand

#	Name	Isotope labeling	Concentration
1	RNA (45-MER)	natural abundance	0.75 mM
2	DB213	natural abundance	0.75 mM
3	DSS	natural abundance	20 uM
4	potassium chloride	natural abundance	20 mM
5	TRIS	[U-2H]	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand

#	Name	Isotope labeling	Concentration
8	RNA (45-MER)	natural abundance	0.75 mM
9	DB213	natural abundance	0.75 mM
10	DSS	natural abundance	20 uM
11	potassium chloride	natural abundance	20 mM
12	TRIS	[U-2H]	10 mM
13	D2O	natural abundance	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand - higher concentration for natural abundance 13C data collection

#	Name	Isotope labeling	Concentration
14	RNA (45-MER)	natural abundance	1.5 mM
15	DB213	natural abundance	1.5 mM
16	DSS	natural abundance	40 uM
17	potassium chloride	natural abundance	40 mM
18	TRIS	[U-2H]	20 mM
19	D2O	natural abundance	100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand - higher concentration for natural abundance 13C data collection Contains 15 mg/mL Pf1 phage for partial sample alignment

#	Name	Isotope labeling	Concentration
20	RNA (45-MER)	natural abundance	1.5 mM
21	DB213	natural abundance	1.5 mM
22	DSS	natural abundance	40 uM
23	potassium chloride	natural abundance	40 mM
24	TRIS	[U-2H]	20 mM
25	Pf1 phage	natural abundance	4.5 mg
26	D2O	natural abundance	100 %

Release date

2011-06-15

Citation

Structure of the HIV-1 frameshift site RNA bound to a small molecule inhibitor of viral replication
Marcheschi, R.J., Tonelli, M., Kumar, A., Butcher, S.E.
ACS Chem. Biol. (2011), 6, 857-864, PubMed 21648432 , DOI 10.1021/cb200082d , Abstract

Related entities 1. RNA (45-MER), : 2 : 1 : 1 entities Detail

Experiments performed 5 experiments Detail

1 2D 1H-1H NOESY

Instrument

Varian Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand

#	Name	Isotope labeling	Concentration
1	RNA (45-MER)	natural abundance	0.75 mM
2	DB213	natural abundance	0.75 mM
3	DSS	natural abundance	20 uM
4	potassium chloride	natural abundance	20 mM
5	TRIS	[U-2H]	10 mM
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

2 2D 1H-1H NOESY

Instrument

Varian Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand

#	Name	Isotope labeling	Concentration
8	RNA (45-MER)	natural abundance	0.75 mM
9	DB213	natural abundance	0.75 mM
10	DSS	natural abundance	20 uM
11	potassium chloride	natural abundance	20 mM
12	TRIS	[U-2H]	10 mM
13	D2O	natural abundance	100 %

3 2D 1H-1H TOCSY

Instrument

Bruker DMX - 750 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand

#	Name	Isotope labeling	Concentration
8	RNA (45-MER)	natural abundance	0.75 mM
9	DB213	natural abundance	0.75 mM
10	DSS	natural abundance	20 uM
11	potassium chloride	natural abundance	20 mM
12	TRIS	[U-2H]	10 mM
13	D2O	natural abundance	100 %

4 2D 1H-13C HSQC

Instrument

Varian Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand - higher concentration for natural abundance 13C data collection

#	Name	Isotope labeling	Concentration
14	RNA (45-MER)	natural abundance	1.5 mM
15	DB213	natural abundance	1.5 mM
16	DSS	natural abundance	40 uM
17	potassium chloride	natural abundance	40 mM
18	TRIS	[U-2H]	20 mM
19	D2O	natural abundance	100 %

5 2D 1H-13C HSQC

Instrument

Varian Avance - 900 MHz

Sample

State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 7.0, Details Equimolar mixture of RNA and DB213 ligand - higher concentration for natural abundance 13C data collection Contains 15 mg/mL Pf1 phage for partial sample alignment

#	Name	Isotope labeling	Concentration
20	RNA (45-MER)	natural abundance	1.5 mM
21	DB213	natural abundance	1.5 mM
22	DSS	natural abundance	40 uM
23	potassium chloride	natural abundance	40 mM
24	TRIS	[U-2H]	20 mM
25	Pf1 phage	natural abundance	4.5 mg
26	D2O	natural abundance	100 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_17436_2l94.nef
Input source #2: Coordindates	2l94.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	L94	N'-{(Z)-amino[4-(amino{[3-(dimethylammonio)propyl]iminio}methyl)phenyl]methylidene}-N,N-dimethylpropane-1,3-diaminium	Assigned chemical shifts, Distance restraints

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40-----
GGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAGGGAAUCUUCCC
|||||||||||||||||||||||||||||||||||||||||||||
GGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAGGGAAUCUUCCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	45	0	0	100.0

Content subtype: combined_17436_2l94.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	431		100.0 (chain: A, length: 45), 100.0 (chain: B, length: 1)
1	Distance restraints	CNS/XPLOR_distance_constraints_5	Warning	949 (1)	noe	100.0 (chain: A, length: 45), 100.0 (chain: B, length: 1)
2	Distance restraints	CNS/XPLOR_distance_constraints_7	OK	55 (1)	undefined	80.0 (chain: A, length: 45)
3	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	96 (1)	hbond	80.0 (chain: A, length: 45)
4	Distance restraints	CNS/XPLOR_distance_constraints_6	Warning	60 (1)	hbond	75.6 (chain: A, length: 45)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_8	OK	328 (328)	.	100.0 (chain: A, length: 45)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_9	OK	40 (40)	.	60.0 (chain: A, length: 45)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 100.0%

--------10--------20--------30--------40-----
GGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAGGGAAUCUUCCC
|||||||||||||||||||||||||||||||||||||||||||||
GGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAGGGAAUCUUCCC

Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%

-
X
|
X

Total number of assignments
- ¹H chemical shifts: 355
- ¹³C chemical shifts: 76

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H22	5.963
2	G	H22	8.272
2	G	H21	5.972
3	G	H21	7.955
4	A	H61	7.809
5	A	H62	7.911
5	A	H61	6.568
6	G	H22	8.049
6	G	H21	6.105
11	G	H21	7.748
12	G	H22	8.393
12	G	H21	5.489
24	G	H21	7.947
25	G	H22	7.947
25	G	H21	5.906
26	G	H21	7.936
27	A	H62	7.806
27	A	H61	6.542
28	A	H62	7.936
28	A	H61	6.556
29	G	H22	8.35
29	G	H21	6.111
30	G	H22	8.401
30	G	H21	5.499
33	A	H62	7.71
33	A	H61	6.348
34	G	H22	8.4
34	G	H21	5.956

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	393	307	78.1
¹³C chemical shifts	301	62	20.6

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	270	188	69.6
¹³C chemical shifts	225	24	10.7

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	123	119	96.7
¹³C chemical shifts	76	38	50.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	36	36	100.0
¹³C chemical shifts	36	25	69.4

Entity_assemble_ID: B

Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID
1	L94

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_5
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
- Total number of restraints: 942
- Weight of restraints: 1.0 (942)
- Potential type of restraints: square-well-parabolic (942)
- Range of distance target values: 2.15, 5.0 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_7
  - Status: OK
  - Experiment type: undefined
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 80.0%
  - Total number of restraints: 55
  - Weight of restraints: 1.0 (55)
  - Potential type of restraints: square-well-parabolic (55)
  - Range of distance target values: 5.6, 18.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
      None
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_4
    - Status: Warning
    - Experiment type: hbond
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 80.0%
    - Total number of restraints: 96
    - Weight of restraints: 1.0 (96)
    - Potential type of restraints: square-well-parabolic (96)
    - Range of distance target values: 1.89, 2.95 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
      - Chain_ID: B
        None
    - Distance restraints on contact map
    - Saveframe: CNS/XPLOR_distance_constraints_6
      - Status: Warning
      - Experiment type: hbond
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 75.6%
        --------10--------20--------30--------40----- GGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAGGGAAUCUUCCC ||||||| |||||||||| |||||||||| ||||||| GGGAAGA..UGGCCUUCCC....GGGAAGGCCA.....UCUUCCC
      - Total number of restraints: 60
        Total hydrogen bond restraints: 60
        O...H-x (too far!): 60
      - Weight of restraints: 1.0 (60)
        Total hydrogen bond restraints: 1.0 (60)
        O...H-x (too far!): 1.0 (60)
      - Potential type of restraints: square-well-parabolic (60)
        Total hydrogen bond restraints: square-well-parabolic (60)
        O...H-x (too far!): square-well-parabolic (60)
      - Range of distance target values: 3.75, 3.75 (Å)
      - Distance restraints per residue
        Chain_ID: A
        Chain_ID: B
        None
      - Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_8
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 100.0%
- Total number of restraints: 328
- Total number of restraints per polymer type: 328
- Weight of restraints: 1.0 (328)
- Potential type of restraints: square-well-parabolic (328)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_9
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 45, Sequence coverage: 60.0%
- Total number of restraints: 40
- Potential type of restraints: square-well-parabolic (40)
- Range of observed RDC values: -13.88, 56.1 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords Frameshift, HIV, Inhibitor, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.468 seconds)

BMRB: 17436

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. RNA (45-MER), : 2 : 1 : 1 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail