BMRBj - BMREntryMaster

Found 1 Document (0.465 seconds)

BMRB: 17601

2LC8

Solution structure of the MLV readthrough pseudoknot

Authors

Houck-Loomis, B., Durney, M.A., D'Souza, V.M.

Assembly

MLV readthrough pseudoknot

Entity

1. MLV readthrough pseudoknot (polymer, Thiol state: not present), 63 monomers, 20411.21 Da Detail

GGAGGUCAGG GUCAGGAGCC CCCCCCUGAA CCCAGGAUAA CCCUCAAAGU CGGGGGGCAA CCC

Formula weight

20411.21 Da

Source organism

Moloney murine leukemia virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 28.1 %, Completeness (bb): 11.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	28.1 % (274 of 975)	32.9 % (182 of 554)	21.9 % (92 of 421)
Suger, PO4	11.7 % (81 of 693)	16.7 % (63 of 378)	5.7 % (18 of 315)
Nucleobase	68.4 % (193 of 282)	67.6 % (119 of 176)	69.8 % (74 of 106)
Aromatic	81.1 % (193 of 238)	90.2 % (119 of 132)	69.8 % (74 of 106)

1. RNA (59-MER)

GGAGGUCAGG GUCAGGAGCC CCCCCCUGAA CCCAGGAUAA CCCUCAAAGU CGGGGGGCAA CCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.4, Details pH 7.4

#	Name	Isotope labeling	Type	Concentration
1	RNA (59-MER)	natural abundance		0.2 ~ 2.0 mM
2	D2O	natural abundance		100 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.4

#	Name	Isotope labeling	Type	Concentration
3	RNA (59-MER)	[U-100% 13C; U-100% 15N]		0.2 ~ 2.0 mM
4	D2O	natural abundance		100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.4

#	Name	Isotope labeling	Type	Concentration
5	RNA (59-MER)	[U-100% 2H]		0.2 ~ 2.0 mM
6	D2O	natural abundance		100 %

Release date

2011-12-01

Citation

An equilibrium-dependent retroviral mRNA switch regulates translational recoding
Houck-Loomis, B., Durney, M.A., Salguero, C., Shankar, N., Nagle, J.M., Goff, S.P.
Nature (2011), 480, 561-564, PubMed 22121021 , DOI 10.1038/nature10657 , Abstract

Related entities 1. MLV readthrough pseudoknot, : 1 entities Detail

Experiments performed 6 experiments Detail

NMR combined restraints 11 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17601_2lc8.nef
Input source #2: Coordindates	2lc8.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--------50--------60---
GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	63	0	0	100.0

Content subtype: combined_17601_2lc8.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	274		100.0 (chain: A, length: 63)
1	Distance restraints	DYANA/DIANA_distance_constraints_5	Warning	2 (1)	noe	4.8 (chain: A, length: 63)
2	Distance restraints	DYANA/DIANA_distance_constraints_7	OK	168 (1)	undefined	88.9 (chain: A, length: 63)
3	Distance restraints	DYANA/DIANA_distance_constraints_10	OK	40 (1)	undefined	38.1 (chain: A, length: 63)
4	Distance restraints	DYANA/DIANA_distance_constraints_9	Warning	388 (1)	noe	88.9 (chain: A, length: 63)
5	Distance restraints	DYANA/DIANA_distance_constraints_3	OK	168 (1)	undefined	88.9 (chain: A, length: 63)
6	Distance restraints	DYANA/DIANA_distance_constraints_6	OK	43 (1)	undefined	39.7 (chain: A, length: 63)
7	Distance restraints	DYANA/DIANA_distance_constraints_4	OK	101 (1)	hbond	57.1 (chain: A, length: 63)
8	Distance restraints	DYANA/DIANA_distance_constraints_8	Warning	99 (1)	hbond	57.1 (chain: A, length: 63)
1	Dihedral angle restraints	DYANA/DIANA_dihedral_2	OK	284 (284)	.	90.5 (chain: A, length: 63)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 182
  - ¹³C chemical shifts: 92
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	554	182	32.9
¹³C chemical shifts	421	92	21.9

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	378	63	16.7
¹³C chemical shifts	315	18	5.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	176	119	67.6
¹³C chemical shifts	106	74	69.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	50	49	98.0
¹³C chemical shifts	50	50	100.0

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_5
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 4.8%
- Total number of restraints: 2
- Weight of restraints: 1.0 (2)
- Potential type of restraints: lower-bound-parabolic (2)
- Range of distance target values: 5.5, 5.5 (Å)
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: DYANA/DIANA_distance_constraints_7
  - Status: OK
  - Experiment type: undefined
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 88.9%
  - Total number of restraints: 168
  - Weight of restraints: 1.0 (168)
  - Potential type of restraints: upper-bound-parabolic (168)
  - Range of distance target values: 1.46, 2.58 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: DYANA/DIANA_distance_constraints_10
    - Status: OK
    - Experiment type: undefined
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 38.1%
    - Total number of restraints: 40
    - Weight of restraints: 1.0 (40)
    - Potential type of restraints: upper-bound-parabolic (40)
    - Range of distance target values: 9.0, 12.0 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map
    - Saveframe: DYANA/DIANA_distance_constraints_9
      - Status: Warning
      - Experiment type: noe
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 88.9%
        --------10--------20--------30--------40--------50--------60--- GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ...GGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCA --------10--------20--------30--------40--------50---------
      - Total number of restraints: 388
        Intra-residue restraints, i = j : 267
        Sequential restraints, | i - j | = 1 : 113
        Backbone-side chain: 76
        Side chain-side chain: 37
        Medium range restraints, 1 < | i - j | < 5 : 2
        Backbone-side chain: 2
        Long range restraints, | i - j | >= 5 : 6
      - Weight of restraints: 1.0 (388)
        Intra-residue restraints, i = j : 1.0 (267)
        Sequential restraints, | i - j | = 1 : 1.0 (113)
        Backbone-side chain: 1.0 (76)
        Side chain-side chain: 1.0 (37)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (2)
        Backbone-side chain: 1.0 (2)
        Long range restraints, | i - j | >= 5 : 1.0 (6)
      - Potential type of restraints: upper-bound-parabolic (388)
        Intra-residue restraints, i = j : upper-bound-parabolic (267)
        Sequential restraints, | i - j | = 1 : upper-bound-parabolic (113)
        Backbone-side chain: upper-bound-parabolic (76)
        Side chain-side chain: upper-bound-parabolic (37)
        Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (2)
        Backbone-side chain: upper-bound-parabolic (2)
        Long range restraints, | i - j | >= 5 : upper-bound-parabolic (6)
      - Range of distance target values: 2.7, 6.5 (Å)
      - Histogram of distance target values
      - Distance restraints per residue
        Chain_ID: A
      - Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
      - Saveframe: DYANA/DIANA_distance_constraints_3
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 88.9%
        --------10--------20--------30--------40--------50--------60--- GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ...GGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCA --------10--------20--------30--------40--------50---------
        Total number of restraints: 168
        Intra-residue restraints, i = j : 168
        Weight of restraints: 1.0 (168)
        Intra-residue restraints, i = j : 1.0 (168)
        Potential type of restraints: lower-bound-parabolic (168)
        Intra-residue restraints, i = j : lower-bound-parabolic (168)
        Range of distance target values: 1.44, 2.48 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
        Saveframe: DYANA/DIANA_distance_constraints_6
        Status: OK
        Experiment type: undefined
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 39.7%
        Total number of restraints: 43
        Medium range restraints, 1 < | i - j | < 5 : 1
        Backbone-backbone: 1
        Long range restraints, | i - j | >= 5 : 42
        Weight of restraints: 1.0 (43)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (1)
        Backbone-backbone: 1.0 (1)
        Long range restraints, | i - j | >= 5 : 1.0 (42)
        Potential type of restraints: lower-bound-parabolic (43)
        Medium range restraints, 1 < | i - j | < 5 : lower-bound-parabolic (1)
        Backbone-backbone: lower-bound-parabolic (1)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (42)
        Range of distance target values: 8.0, 11.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Distance restraints on contact map
        Saveframe: DYANA/DIANA_distance_constraints_4
        Status: OK
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 57.1%
        --------10--------20--------30--------40--------50--------60--- GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC     ||| |||||||| ||||||||||| ||||  |||             |||||||      ....GUC.GGGUCAGG.GCCCCCCCCUG.ACCC..GAU.............GGGGGGC --------10--------20--------30--------40--------50--------
        Total number of restraints: 101
        Long range restraints, | i - j | >= 5 : 1
        Total hydrogen bond restraints: 100
        Weight of restraints: 1.0 (101)
        Long range restraints, | i - j | >= 5 : 1.0 (1)
        Total hydrogen bond restraints: 1.0 (100)
        Potential type of restraints: lower-bound-parabolic (101)
        Long range restraints, | i - j | >= 5 : lower-bound-parabolic (1)
        Total hydrogen bond restraints: lower-bound-parabolic (100)
        Range of distance target values: 1.8, 5.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A
        Saveframe: DYANA/DIANA_distance_constraints_8
        Status: Warning
        Experiment type: hbond
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 57.1%
        --------10--------20--------30--------40--------50--------60--- GGAGGUCAGGGUCAGGAGCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGGGGCAACCC     ||| |||||||| ||||||||||| ||||  |||             |||||||      ....GUC.GGGUCAGG.GCCCCCCCCUG.ACCC..GAU.............GGGGGGC --------10--------20--------30--------40--------50--------
        Total number of restraints: 99
        Total hydrogen bond restraints: 99
        Weight of restraints: 1.0 (99)
        Total hydrogen bond restraints: 1.0 (99)
        Potential type of restraints: upper-bound-parabolic (99)
        Total hydrogen bond restraints: upper-bound-parabolic (99)
        Range of distance target values: 1.89, 3.0 (Å)
        Histogram of distance target values
        Distance restraints per residue
        Chain_ID: A
        Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

Saveframe: DYANA/DIANA_dihedral_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 63, Sequence coverage: 90.5%
- Total number of restraints: 284
- Total number of restraints per polymer type: 284
- Weight of restraints: 1.0 (284)
- Potential type of restraints: square-well-parabolic (284)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords frameshift, MLV, NMR, pseudoknot, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.465 seconds)

BMRB: 17601

Sample #1

Sample #2

Sample #3

Related entities 1. MLV readthrough pseudoknot, : 1 entities Detail

Experiments performed 6 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 11 contents Detail