BMRBj - BMREntryMaster

Found 1 Document (0.349 seconds)

BMRB: 17671

2LDL

Solution NMR Structure of the HIV-1 Exon Splicing Silencer 3

Authors

Mishler, C., Levengood, J.D., Johnson, C.A., Rajan, P., Znosko, B.M.

Assembly

RNA (27-MER)

Entity

1. RNA (27-MER) (polymer), 27 monomers, 8713.146 Da Detail

XGAUCCAUUC GAUUAGUGAA CGGAUCC

Formula weight

8713.146 Da

Source organism

Human immunodeficiency virus 1

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 92.6 %, Completeness: 80.0 %, Completeness (bb): 80.1 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	80.0 % (333 of 416)	81.1 % (184 of 227)	80.1 % (141 of 176)	61.5 % (8 of 13)
Suger, PO4	80.1 % (229 of 286)	84.6 % (132 of 156)	74.6 % (97 of 130)
Nucleobase	80.0 % (104 of 130)	73.2 % (52 of 71)	95.7 % (44 of 46)	61.5 % (8 of 13)
Aromatic	88.1 % (104 of 118)	88.1 % (52 of 59)	95.7 % (44 of 46)	61.5 % (8 of 13)

1. RNA (27-MER)

XGAUCCAUUC GAUUAGUGAA CGGAUCC

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

Release date

2012-03-06

Citation

Solution structure of the HIV-1 exon splicing silencer 3
Levengood, J.D., Rollins, C., Mishler, C.H.J., Johnson, C.A., Miner, G., Rajan, P., Znosko, B.M., Tolbert, B.S.
J. Mol. Biol. (2012), 415, 680-698, PubMed 22154809 , DOI 10.1016/j.jmb.2011.11.034 , Abstract

Related entities 1. RNA (27-MER), : 1 entities Detail

Experiments performed 5 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Avance - 850 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

2 2D HNN-COSY

Instrument

Bruker DMX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 850 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

4 2D 1H-1H TOCSY

Instrument

Bruker Avance - 850 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

5 2D 1H-13C HMQC

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (27-MER)	natural abundance		1.0 ~ 2.0 mM
2	RNA (27-MER)	[U-100% 15N]		0.5 ~ 1.0 mM
3	RNA (27-MER)	[U-100% 13C]		0.5 ~ 1.0 mM
4	RNA (27-MER)	[U-2H]		0.5 ~ 1.0 mM
5	potassium chloride	natural abundance		120 mM
6	potassium phosphate	natural abundance		20 mM
7	cacodylate	natural abundance		10 mM
8	EDTA	natural abundance		0.5 mM
9	D2O	natural abundance		100 %

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17671_2ldl.nef
Input source #2: Coordindates	2ldl.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-------
GGAUCCAUUCGAUUAGUGAACGGAUCC
|||||||||||||||||||||||||||
GGAUCCAUUCGAUUAGUGAACGGAUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_17671_2ldl.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	341		92.6 (chain: A, length: 27)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	389 (1)	noe	100.0 (chain: A, length: 27)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	7 (1)	undefined	29.6 (chain: A, length: 27)
3	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	7 (1)	hbond	18.5 (chain: A, length: 27)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	157 (157)	.	100.0 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 92.6%
- Total number of assignments
  - ¹H chemical shifts: 184
  - ¹³C chemical shifts: 141
  - ¹⁵N chemical shifts: 16
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 389
- Weight of restraints: 1.0 (389)
- Potential type of restraints: square-well-parabolic (389)
- Range of distance target values: 2.4, 5.25 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: undefined
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 29.6%
  - Total number of restraints: 7
  - Weight of restraints: 1.0 (7)
  - Potential type of restraints: square-well-parabolic (7)
  - Range of distance target values: 12.25, 12.25 (Å)
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_4
    - Status: Warning
    - Experiment type: hbond
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 18.5%
    - Total number of restraints: 7
    - Weight of restraints: 1.0 (7)
    - Potential type of restraints: square-well-parabolic (7)
    - Range of distance target values: 4.75, 4.75 (Å)
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 157
- Total number of restraints per polymer type: 157
- Weight of restraints: 1.0 (157)
- Potential type of restraints: square-well-parabolic (157)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords exon splicing silencer, HIV, RNA