BMRBj - BMREntryMaster

Found 1 Document (0.384 seconds)

BMRB: 17682

2LDT

The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA

Authors

Spano, M.NEWBY., Walter, N.G.

Assembly

RNA (31-MER)

Entity

1. RNA (31-MER) (polymer, Thiol state: not present), 31 monomers, 10075.02 Da Detail

GGGGAGUACG GCCGCAAGGU UAAAACUCCC C

Formula weight

10075.02 Da

Source organism

Escherichia coli

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 37.7 %, Completeness (bb): 22.6 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	37.7 % (185 of 491)	54.1 % (146 of 270)	18.8 % (39 of 207)	0.0 % (0 of 14)
Suger, PO4	22.6 % (77 of 341)	41.4 % (77 of 186)	0.0 % (0 of 155)
Nucleobase	72.0 % (108 of 150)	82.1 % (69 of 84)	75.0 % (39 of 52)	0.0 % (0 of 14)
Aromatic	76.5 % (101 of 132)	93.9 % (62 of 66)	75.0 % (39 of 52)	0.0 % (0 of 14)

1. RNA (31-MER)

GGGGAGUACG GCCGCAAGGU UAAAACUCCC C

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

Release date

2011-08-31

Citation

Solution structure of an alternate conformation of helix27 from Escherichia coli16S rRNA
Spano, M., Walter, N.G.
Biopolymers (2011), 95, 653-668, PubMed 21442607 , DOI 10.1002/bip.21626 , Abstract

Related entities 1. RNA (31-MER), : 1 : 100 entities Detail

Experiments performed 5 experiments Detail

1 2D 1H-1H TOCSY

Instrument

Varian INOVA - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.4, Details Final RNA concentrations for the samples ranged from 0.8 to 1.6 mM, as quantified by UV absorption

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

2 2D DQF-COSY

Instrument

Varian INOVA - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

3 2D 1H-15N HSQC

Instrument

Varian INOVA - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

4 2D 1H-13C HSQC

Instrument

Varian INOVA - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

5 2D 1H-1H NOESY

Instrument

Varian INOVA - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
1	RNA (31-MER)	[U-99% 13C; U-99% 15N]	0.8 ~ 1.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %
4	NaPi	natural abundance	10 mM
5	EDTA	natural abundance	0.1 mM
6	NaCl	natural abundance	50 mM

NMR combined restraints 9 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_17682_2ldt.nef
Input source #2: Coordindates	2ldt.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30-
GGGGAGUACGGCCGCAAGGUUAAAACUCCCC
|||||||||||||||||||||||||||||||
GGGGAGUACGGCCGCAAGGUUAAAACUCCCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	31	0	0	100.0

Content subtype: combined_17682_2ldt.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	204		100.0 (chain: A, length: 31)
1	Distance restraints	CNS/XPLOR_distance_constraints_10	Warning	379 (1)	noe	100.0 (chain: A, length: 31)
2	Distance restraints	CNS/XPLOR_distance_constraints_9	Warning	70 (1)	hbond	80.6 (chain: A, length: 31)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_2	OK	61 (61)	.	100.0 (chain: A, length: 31)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	147 (147)	.	67.7 (chain: A, length: 31)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_7	OK	61 (61)	.	87.1 (chain: A, length: 31)
4	Dihedral angle restraints	CNS/XPLOR_dihedral_6	OK	29 (29)	.	93.5 (chain: A, length: 31)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_8	Warning	12 (12)	.	29.0 (chain: A, length: 31)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 100.0%

--------10--------20--------30-
GGGGAGUACGGCCGCAAGGUUAAAACUCCCC
|||||||||||||||||||||||||||||||
GGGGAGUACGGCCGCAAGGUUAAAACUCCCC

Total number of assignments
- ¹H chemical shifts: 157
- ¹³C chemical shifts: 39
- ¹⁵N chemical shifts: 8

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H21	8.41
3	G	H22	5.345
4	G	H22	8.217
4	G	H21	5.682
5	A	H62	7.787
5	A	H61	5.483
5	A	N1	155.124
6	G	H22	7.868
6	G	H21	5.715
8	A	N1	154.956
11	G	H22	6.458
11	G	H21	5.286
16	A	N1	155.214
17	A	N1	155.617
18	G	H21	8.455
22	A	N1	154.931
23	A	N1	154.214
24	A	N1	155.727
25	A	N1	153.868

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	270	146	54.1
¹³C chemical shifts	207	39	18.8
¹⁵N chemical shifts	14	0	0.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	186	77	41.4
¹³C chemical shifts	155	0	0.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	84	69	82.1
¹³C chemical shifts	52	39	75.0
¹⁵N chemical shifts	14	0	0.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	26	26	100.0
¹³C chemical shifts	26	26	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_10
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 100.0%
- Total number of restraints: 379
- Weight of restraints: 1.0 (379)
- Potential type of restraints: square-well-parabolic (379)
- Range of distance target values: 2.25, 5.1 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_9
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 80.6%
  - Total number of restraints: 70
  - Weight of restraints: 1.0 (70)
  - Potential type of restraints: square-well-parabolic (70)
  - Range of distance target values: 1.46, 4.09 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 100.0%
- Total number of restraints: 61
- Total number of restraints per polymer type: 61
- Weight of restraints: 1.0 (61)
- Potential type of restraints: square-well-parabolic (61)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_5
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 67.7%
  - Total number of restraints: 147
  - Total number of restraints per polymer type: 147
  - Weight of restraints: 1.0 (147)
  - Potential type of restraints: square-well-parabolic (147)
  - Dihedral angle restraints per residue
    - Chain_ID: A
  - Saveframe: CNS/XPLOR_dihedral_7
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 87.1%
    - Total number of restraints: 61
    - Total number of restraints per polymer type: 61
    - Weight of restraints: 1.0 (61)
    - Potential type of restraints: square-well-parabolic (61)
    - Dihedral angle restraints per residue
      - Chain_ID: A
    - Saveframe: CNS/XPLOR_dihedral_6
      - Status: OK
      - Experiment type: .
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 93.5%
        --------10--------20--------30- GGGGAGUACGGCCGCAAGGUUAAAACUCCCC ||||||||||||||||||||| || |||||| GGGGAGUACGGCCGCAAGGUU.AA.CUCCCC
      - Total number of restraints: 29
        Delta angle constraints: 29
      - Total number of restraints per polymer type: 29
        Nucleic acid: 29
      - Weight of restraints: 1.0 (29)
        Delta angle constraints: 1.0 (29)
      - Potential type of restraints: square-well-parabolic (29)
        Delta angle constraints: square-well-parabolic (29)
      - Dihedral angle restraints per residue
        Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_8
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 29.0%
- Total number of restraints: 12
- Potential type of restraints: undefined (12)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue

Keywords NMR, RNA, rRNA, switch helix

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.384 seconds)

BMRB: 17682

Sample

Related entities 1. RNA (31-MER), : 1 : 100 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 9 contents Detail