BMRBj - BMREntryMaster

Found 1 Document (0.439 seconds)

BMRB: 17877

2LI4

Solution structure of a shortened antiterminator hairpin from a Mg2+ riboswitch

Authors

Korth, M.M. T., Sigel, R.K. O.

Assembly

RNA (32-MER)

Entity

1. RNA (32-MER) (polymer, Thiol state: not present), 32 monomers, 10367.15 Da Detail

GGACCGAUAA GGUAGAAAUG CCUUAUCGGU CC

Formula weight

10367.15 Da

Source organism

Yersinia enterocolitica

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 83.8 %, Completeness (bb): 92.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	83.8 % (232 of 277)	83.8 % (232 of 277)
Suger, PO4	92.2 % (177 of 192)	92.2 % (177 of 192)
Nucleobase	64.7 % (55 of 85)	64.7 % (55 of 85)
Aromatic	77.5 % (55 of 71)	77.5 % (55 of 71)

1. RNA (32-MER)

GGACCGAUAA GGUAGAAAUG CCUUAUCGGU CC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.8, Details YE loop C short

#	Name	Isotope labeling	Concentration
1	potassium chloride	natural abundance	50 mM
2	EDTA	natural abundance	10 uM
3	RNA (32-MER)	natural abundance	0.24 mM
4	D2O	natural abundance	100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 303 K, pH 6.8, Details YE loop C short

#	Name	Isotope labeling	Concentration
5	potassium chloride	natural abundance	50 mM
6	EDTA	natural abundance	10 uM
7	RNA (32-MER)	natural abundance	0.6 mM
8	D2O	natural abundance	10 %
9	H2O	natural abundance	90 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.8, Details YE loop C short, partially deuterated

#	Name	Isotope labeling	Concentration
10	potassium chloride	natural abundance	50 mM
11	EDTA	natural abundance	10 uM
12	RNA (32-MER)	natural abundance	0.8 mM
13	D2O	natural abundance	100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.8, Details YE loop C short

#	Name	Isotope labeling	Concentration
14	potassium chloride	natural abundance	50 mM
15	EDTA	natural abundance	10 uM
16	RNA (32-MER)	natural abundance	0.5 mM
17	D2O	natural abundance	100 %

Release date

2012-08-21

Citation

Unusually high-affinity Mg(2+) binding at the AU-rich sequence within the antiterminator hairpin of a Mg(2+) riboswitch
Korth, M.M.T., Sigel, R.K.O.
Chem. Biodivers. (2012), 9, 2035-2049, PubMed 22976989 , DOI 10.1002/cbdv.201200031 , Abstract

Related entities 1. RNA (32-MER), : 2 entities Detail

Experiments performed 4 experiments Detail

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17877_2li4.nef
Input source #2: Coordindates	2li4.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--
GGACCGAUAAGGUAGAAAUGCCUUAUCGGUCC
||||||||||||||||||||||||||||||||
GGACCGAUAAGGUAGAAAUGCCUUAUCGGUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	32	0	0	100.0

Content subtype: combined_17877_2li4.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	232		100.0 (chain: A, length: 32)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	496 (1)	noe	100.0 (chain: A, length: 32)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	73 (1)	hbond	93.8 (chain: A, length: 32)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	237 (237)	.	100.0 (chain: A, length: 32)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 232
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	277	232	83.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	192	177	92.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	85	55	64.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	27	27	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 496
- Weight of restraints: 1.0 (496)
- Potential type of restraints: square-well-parabolic (496)
- Range of distance target values: 1.85, 5.5 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 93.8%
  - Total number of restraints: 73
  - Weight of restraints: 1.0 (73)
  - Potential type of restraints: square-well-parabolic (73)
  - Range of distance target values: 1.9, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 237
- Total number of restraints per polymer type: 237
- Weight of restraints: 1.0 (237)
- Potential type of restraints: square-well-parabolic (237)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.439 seconds)

BMRB: 17877

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. RNA (32-MER), : 2 entities Detail

Experiments performed 4 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail