BMRBj - BMREntryMaster

Found 1 Document (0.339 seconds)

BMRB: 17941

2LJJ

the structure of subdomain IV-B from the CVB-3 IRES

Authors

Ihle, Y., Zell, R., Goerlach, M.

Assembly

IV-B RNA

Entity

1. IV-B RNA (polymer, Thiol state: not present), 27 monomers, 8663.130 Da Detail

GGCCUCAGCA CUACCCCAGU GUAGGUC

Formula weight

8663.13 Da

Source organism

Coxsackievirus B3

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 90.3 %, Completeness (bb): 91.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	90.3 % (417 of 462)	94.2 % (227 of 241)	98.4 % (179 of 182)	75.0 % (9 of 12)	7.4 % (2 of 27)
Suger, PO4	91.7 % (297 of 324)	99.4 % (161 of 162)	99.3 % (134 of 135)		7.4 % (2 of 27)
Nucleobase	87.0 % (120 of 138)	83.5 % (66 of 79)	95.7 % (45 of 47)	75.0 % (9 of 12)
Aromatic	93.2 % (110 of 118)	94.9 % (56 of 59)	95.7 % (45 of 47)	75.0 % (9 of 12)

1. IV-B RNA

GGCCUCAGCA CUACCCCAGU GUAGGUC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	IV-B RNA	[U-100% 15N]	1 mM
2	potassium phosphate	natural abundance	10 mM
3	potassium chloride	natural abundance	40 mM
4	EDTA	natural abundance	200 uM
5	H2O	natural abundance	90 %
6	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.2

#	Name	Isotope labeling	Concentration
7	IV-B RNA	[U-100% 13C; U-100% 15N]	1 mM
8	potassium phosphate	natural abundance	10 mM
9	potassium chloride	natural abundance	40 mM
10	EDTA	natural abundance	200 uM
11	D2O	natural abundance	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.2

#	Name	Isotope labeling	Concentration
12	IV-B RNA	[U-13C; U-15N]-Ade,Cyt	1 mM
13	potassium phosphate	natural abundance	10 mM
14	potassium chloride	natural abundance	40 mM
15	EDTA	natural abundance	200 uM
16	D2O	natural abundance	100 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.2

#	Name	Isotope labeling	Concentration
17	IV-B RNA	[U-13C; U-15N]-Gua,Ura	1 mM
18	potassium phosphate	natural abundance	10 mM
19	potassium chloride	natural abundance	40 mM
20	EDTA	natural abundance	200 uM
21	D2O	natural abundance	100 %

Release date

2012-09-16

Citation

The Structure of Subdomain IV-B from the CVB-3 IRES
Ihle, Y.
Not known

Related entities 1. IV-B RNA, : 1 entities Detail

Experiments performed 1 experiments Detail

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17941_2ljj.nef
Input source #2: Coordindates	2ljj.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

290-----300-------310------
GGCCUCAGCACUACCCCAGUGUAGGUC
|||||||||||||||||||||||||||
GGCCUCAGCACUACCCCAGUGUAGGUC
--------10--------20-------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_17941_2ljj.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	471		100.0 (chain: A, length: 27)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	883 (1)	noe	100.0 (chain: A, length: 27)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	38 (1)	hbond	51.9 (chain: A, length: 27)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	239 (239)	.	100.0 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%

290-----300-------310------
GGCCUCAGCACUACCCCAGUGUAGGUC
|||||||||||||||||||||||||||
GGCCUCAGCACUACCCCAGUGUAGGUC

Total number of assignments
- ¹H chemical shifts: 243
- ¹³C chemical shifts: 179
- ¹⁵N chemical shifts: 47
- ³¹P chemical shifts: 2

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
290	G	HO2'	6.848
290	G	N9	169.118
291	G	H21	6.203
291	G	H22	6.203
291	G	HO2'	7.072
291	G	N2	71.063
291	G	N9	170.219
292	C	HO2'	6.615
292	C	N1	151.555
292	C	N3	195.727
292	C	N4	98.291
293	C	HO2'	6.464
293	C	N1	151.136
293	C	N3	194.951
293	C	N4	96.406
294	U	N1	145.814
295	C	N1	150.281
296	A	N9	168.911
297	G	H21	6.163
297	G	H22	6.163
297	G	N2	71.654
297	G	N9	169.917
298	C	HO2'	6.547
298	C	N1	150.745
298	C	N3	195.533
298	C	N4	96.727
299	A	H61	6.263
299	A	H62	7.865
299	A	HO2'	6.711
299	A	N1	219.906
299	A	N6	82.202
299	A	N9	170.684
300	C	N1	150.913
300	C	N3	195.242
300	C	N4	96.999
303	C	N1	151.986
304	C	N1	152.129
304	C	P	-1.163
305	C	N1	152.51
306	C	N1	152.655
307	A	N9	170.026
308	G	N9	169.057
309	U	HO2'	6.81
309	U	N1	145.768
310	G	HO2'	6.885
310	G	N9	170.313
311	U	HO2'	6.907
311	U	N1	145.333
312	A	N9	167.568
313	G	N9	169.607
314	G	HO2'	6.813
314	G	N9	169.739
315	U	N1	145.573
316	C	N1	150.909
316	C	N4	97.095
316	C	P	-1.498

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	241	227	94.2
¹³C chemical shifts	182	179	98.4
¹⁵N chemical shifts	12	9	75.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	162	161	99.4
¹³C chemical shifts	135	134	99.3

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	79	66	83.5
¹³C chemical shifts	47	45	95.7
¹⁵N chemical shifts	12	9	75.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	17	17	100.0
¹³C chemical shifts	17	17	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 883
- Weight of restraints: 1.0 (883)
- Potential type of restraints: square-well-parabolic (883)
- Range of distance target values: 2.3, 4.74 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 51.9%
  - Total number of restraints: 38
  - Weight of restraints: 1.0 (38)
  - Potential type of restraints: square-well-parabolic (38)
  - Range of distance target values: 1.9, 2.85 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 239
- Total number of restraints per polymer type: 239
- Weight of restraints: 1.0 (239)
- Potential type of restraints: square-well-parabolic (239)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords Coxsackievirus B3, hairpin, Internal Ribosomal Entry Site, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.339 seconds)

BMRB: 17941

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. IV-B RNA, : 1 entities Detail

Experiments performed 1 experiments Detail

Instrument

Sample

NMR combined restraints 5 contents Detail