BMRBj - BMREntryMaster

Found 1 Document (0.452 seconds)

BMRB: 17961

2LKR

S. cerevisiae U2/U6 snRNA complex

Authors

Burke, J.E., Sashital, D.G., Zuo, X., Wang, Y., Butcher, S.E.

Assembly

U2U6111

Entity

1. U2U6111 (polymer, Thiol state: not present), 111 monomers, 35624.92 Da Detail

GGCAAUACAG AGAUGAUCAG CAGUUCCCCU GCAUAAGGAU GAACCGUUUU ACAAAGAGAU UUCUUCGGGA AUCUCUUUGC CUUUUGGCUU AGAUCAAGUG UAGUAUCUGU C

Formula weight

35624.92 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 37.8 %, Completeness: 4.1 %, Completeness (bb): 0.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹⁵N
All	4.1 % (42 of 1027)	4.3 % (42 of 967)	0.0 % (0 of 60)
Suger, PO4	0.0 % (0 of 666)	0.0 % (0 of 666)
Nucleobase	11.6 % (42 of 361)	14.0 % (42 of 301)	0.0 % (0 of 60)
Aromatic	13.2 % (42 of 317)	16.3 % (42 of 257)	0.0 % (0 of 60)

1. U2U6111

GGCAAUACAG AGAUGAUCAG CAGUUCCCCU GCAUAAGGAU GAACCGUUUU ACAAAGAGAU UUCUUCGGGA AUCUCUUUGC CUUUUGGCUU AGAUCAAGUG UAGUAUCUGU C

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
1	U2U6111	natural abundance		0.6-0.8 mM
2	potassium phosphate	natural abundance		20 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
3	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura		0.6-0.8 mM
4	potassium phosphate	natural abundance		20 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
5	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
6	potassium phosphate	natural abundance	20 mM
7	magnesium chloride	natural abundance	2 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
8	U2U6111	natural abundance	0.6-0.8 mM
9	potassium phosphate	natural abundance	20 mM
10	magnesium chloride	natural abundance	2 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
11	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
12	potassium phosphate	natural abundance	20 mM
13	magnesium chloride	natural abundance	2 mM
14	Pf1 phage	natural abundance	10 mg/mL

Chem. Shift Complete2

Sequence coverage: 26.1 %, Completeness: 4.8 %, Completeness (bb): 0.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹⁵N
All	4.8 % (99 of 2054)	3.6 % (70 of 1934)	24.2 % (29 of 120)
Suger, PO4	0.0 % (0 of 1332)	0.0 % (0 of 1332)
Nucleobase	13.7 % (99 of 722)	11.6 % (70 of 602)	24.2 % (29 of 120)
Aromatic	15.6 % (99 of 634)	13.6 % (70 of 514)	24.2 % (29 of 120)

1. U2U6111

GGCAAUACAG AGAUGAUCAG CAGUUCCCCU GCAUAAGGAU GAACCGUUUU ACAAAGAGAU UUCUUCGGGA AUCUCUUUGC CUUUUGGCUU AGAUCAAGUG UAGUAUCUGU C

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
1	U2U6111	natural abundance		0.6-0.8 mM
2	potassium phosphate	natural abundance		20 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
3	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura		0.6-0.8 mM
4	potassium phosphate	natural abundance		20 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
5	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
6	potassium phosphate	natural abundance	20 mM
7	magnesium chloride	natural abundance	2 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
8	U2U6111	natural abundance	0.6-0.8 mM
9	potassium phosphate	natural abundance	20 mM
10	magnesium chloride	natural abundance	2 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
11	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
12	potassium phosphate	natural abundance	20 mM
13	magnesium chloride	natural abundance	2 mM
14	Pf1 phage	natural abundance	10 mg/mL

Chem. Shift Complete3

Sequence coverage: 40.5 %, Completeness: 4.7 %, Completeness (bb): 0.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹⁵N
All	4.7 % (144 of 3081)	4.0 % (115 of 2901)	16.1 % (29 of 180)
Suger, PO4	0.0 % (0 of 1998)	0.0 % (0 of 1998)
Nucleobase	13.3 % (144 of 1083)	12.7 % (115 of 903)	16.1 % (29 of 180)
Aromatic	15.1 % (144 of 951)	14.9 % (115 of 771)	16.1 % (29 of 180)

1. U2U6111

GGCAAUACAG AGAUGAUCAG CAGUUCCCCU GCAUAAGGAU GAACCGUUUU ACAAAGAGAU UUCUUCGGGA AUCUCUUUGC CUUUUGGCUU AGAUCAAGUG UAGUAUCUGU C

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
1	U2U6111	natural abundance		0.6-0.8 mM
2	potassium phosphate	natural abundance		20 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
3	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura		0.6-0.8 mM
4	potassium phosphate	natural abundance		20 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
5	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
6	potassium phosphate	natural abundance	20 mM
7	magnesium chloride	natural abundance	2 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
8	U2U6111	natural abundance	0.6-0.8 mM
9	potassium phosphate	natural abundance	20 mM
10	magnesium chloride	natural abundance	2 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
11	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
12	potassium phosphate	natural abundance	20 mM
13	magnesium chloride	natural abundance	2 mM
14	Pf1 phage	natural abundance	10 mg/mL

Chem. Shift Complete4

Sequence coverage: 22.5 %, Completeness: 4.7 %, Completeness (bb): 0.0 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹⁵N
All	4.7 % (194 of 4108)	3.6 % (140 of 3868)	22.5 % (54 of 240)
Suger, PO4	0.0 % (0 of 2664)	0.0 % (0 of 2664)
Nucleobase	13.4 % (194 of 1444)	11.6 % (140 of 1204)	22.5 % (54 of 240)
Aromatic	15.3 % (194 of 1268)	13.6 % (140 of 1028)	22.5 % (54 of 240)

1. U2U6111

GGCAAUACAG AGAUGAUCAG CAGUUCCCCU GCAUAAGGAU GAACCGUUUU ACAAAGAGAU UUCUUCGGGA AUCUCUUUGC CUUUUGGCUU AGAUCAAGUG UAGUAUCUGU C

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
1	U2U6111	natural abundance		0.6-0.8 mM
2	potassium phosphate	natural abundance		20 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Type	Concentration
3	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura		0.6-0.8 mM
4	potassium phosphate	natural abundance		20 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
5	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
6	potassium phosphate	natural abundance	20 mM
7	magnesium chloride	natural abundance	2 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
8	U2U6111	natural abundance	0.6-0.8 mM
9	potassium phosphate	natural abundance	20 mM
10	magnesium chloride	natural abundance	2 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0

#	Name	Isotope labeling	Concentration
11	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
12	potassium phosphate	natural abundance	20 mM
13	magnesium chloride	natural abundance	2 mM
14	Pf1 phage	natural abundance	10 mg/mL

Release date

2012-02-11

Citation

Structure of the yeast U2/U6 snRNA complex
Burke, J.E., Sashital, D.G., Zuo, X., Wang, Y., Butcher, S.E.
RNA (2012), 18, 673-683, PubMed 22328579 , DOI 10.1261/rna.031138.111 , Abstract

Entries sharing articles BMRB: 1 entries Detail

BMRB: 17972 released on 2012-02-19
Title U2/U6 Helix I

Related entities 1. U2U6111, : 1 entities Detail

#	Name	Isotope labeling	Concentration
11	U2U6111	[U-13C; U-15N]-Gua; [U-13C; U-15N]-Ura	0.3-0.5 mM
12	potassium phosphate	natural abundance	20 mM
13	magnesium chloride	natural abundance	2 mM
14	Pf1 phage	natural abundance	10 mg/mL

NMR combined restraints 12 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_17961_2lkr.nef
Input source #2: Coordindates	2lkr.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40--------50--------60--------70--------80--------90-------100
GGCAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUCUUCGGGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGCAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUCUUCGGGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUG

-------110-
UAGUAUCUGUC
|||||||||||
UAGUAUCUGUC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	111	0	0	100.0

Content subtype: combined_17961_2lkr.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	42		37.8 (chain: A, length: 111)
2	Assigned chemical shifts	assigned_chem_shift_list_2	Warning	57		26.1 (chain: A, length: 111)
3	Assigned chemical shifts	assigned_chem_shift_list_3	OK	45		40.5 (chain: A, length: 111)
4	Assigned chemical shifts	assigned_chem_shift_list_4	Warning	50		22.5 (chain: A, length: 111)
1	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	831 (1)	noe	79.3 (chain: A, length: 111)
2	Distance restraints	CNS/XPLOR_distance_constraints_8	Warning	10 (1)	undefined	9.9 (chain: A, length: 111)
3	Distance restraints	CNS/XPLOR_distance_constraints_9	OK	39 (1)	undefined	42.3 (chain: A, length: 111)
4	Distance restraints	CNS/XPLOR_distance_constraints_7	Warning	182 (1)	hbond	66.7 (chain: A, length: 111)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_2	OK	368 (368)	.	61.3 (chain: A, length: 111)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	160 (160)	.	61.3 (chain: A, length: 111)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_6	Warning	17 (17)	.	15.3 (chain: A, length: 111)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 37.8%
- Total number of assignments
  - ¹H chemical shifts: 42
- Completeness of assignments
- Histogram of normalized assigned chemical shifts
Saveframe: assigned_chem_shift_list_2
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 26.1%
- Total number of assignments
  - ¹H chemical shifts: 28
  - ¹⁵N chemical shifts: 29
- Completeness of assignments
- Histogram of normalized assigned chemical shifts
Saveframe: assigned_chem_shift_list_3
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 40.5%
- Total number of assignments
  - ¹H chemical shifts: 45
- Completeness of assignments
- Histogram of normalized assigned chemical shifts
Saveframe: assigned_chem_shift_list_4
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 22.5%
- Total number of assignments
  - ¹H chemical shifts: 25
  - ¹⁵N chemical shifts: 25
- Completeness of assignments
- Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_4
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 79.3%
- Total number of restraints: 831
- Weight of restraints: 1.0 (831)
- Potential type of restraints: square-well-parabolic (831)
- Range of distance target values: 1.63, 14.45 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_8
  - Status: Warning
  - Experiment type: undefined
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 9.9%
  - Total number of restraints: 10
  - Weight of restraints: 1.0 (10)
  - Potential type of restraints: square-well-parabolic (10)
  - Range of distance target values: 13.0, 95.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_9
    - Status: OK
    - Experiment type: undefined
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 42.3%
    - Total number of restraints: 39
    - Weight of restraints: 1.0 (39)
    - Potential type of restraints: square-well-parabolic (39)
    - Range of distance target values: 5.4, 5.4 (Å)
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map
    - Saveframe: CNS/XPLOR_distance_constraints_7
      - Status: Warning
      - Experiment type: hbond
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 66.7%
        --------10--------20--------30--------40--------50--------60--------70--------80--------90-------100 GGCAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUCUUCGGGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUG |||||||| |||||||| |||| |||| |||| |||| ||||||||||||| ||||||||||||| ||| ||||| GGCAAUAC.....UGAUCAGC.GUUC.CCUG...AAGG..GAAC.......CAAAGAGAUUUCU..GGGAAUCUCUUUG.......GCU..GAUCA.... -------110- UAGUAUCUGUC |||| |||| ..GUAU.UGUC
      - Total number of restraints: 182
        Medium range restraints, 1 < | i - j | < 5 : 3
        Side chain-side chain: 2
        Total hydrogen bond restraints: 179
        O...H-x: 5
        O...h-N: 3
        N...H-x: 3
        N...h_N: 3
        N...h_N (too far!): 1
        Long range: 164
        O...H-x: 50
        O...h-N: 50
        N...H-x: 32
        N...h_N: 32
      - Weight of restraints: 1.0 (182)
        Medium range restraints, 1 < | i - j | < 5 : 1.0 (3)
        Side chain-side chain: 1.0 (2)
        Total hydrogen bond restraints: 1.0 (179)
        O...H-x: 1.0 (5)
        O...h-N: 1.0 (3)
        N...H-x: 1.0 (3)
        N...h_N: 1.0 (3)
        N...h_N (too far!): 1.0 (1)
        Long range: 1.0 (164)
        O...H-x: 1.0 (50)
        O...h-N: 1.0 (50)
        N...H-x: 1.0 (32)
        N...h_N: 1.0 (32)
      - Potential type of restraints: square-well-parabolic (182)
        Medium range restraints, 1 < | i - j | < 5 : square-well-parabolic (3)
        Side chain-side chain: square-well-parabolic (2)
        Total hydrogen bond restraints: square-well-parabolic (179)
        O...H-x: square-well-parabolic (5)
        O...h-N: square-well-parabolic (3)
        N...H-x: square-well-parabolic (3)
        N...h_N: square-well-parabolic (3)
        N...h_N (too far!): square-well-parabolic (1)
        Long range: square-well-parabolic (164)
        O...H-x: square-well-parabolic (50)
        O...h-N: square-well-parabolic (50)
        N...H-x: square-well-parabolic (32)
        N...h_N: square-well-parabolic (32)
      - Range of distance target values: 1.7, 4.6 (Å)
      - Histogram of distance target values
      - Distance restraints per residue
        Chain_ID: A
      - Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 61.3%
- Total number of restraints: 368
- Total number of restraints per polymer type: 368
- Weight of restraints: 1.0 (368)
- Potential type of restraints: square-well-parabolic (368)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_3
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 61.3%
  - Total number of restraints: 160
  - Total number of restraints per polymer type: 160
  - Weight of restraints: 1.0 (160)
  - Potential type of restraints: square-well-parabolic (160)
  - Dihedral angle restraints per residue
    - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_6
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 111, Sequence coverage: 15.3%
- Total number of restraints: 17
- Potential type of restraints: square-well-parabolic (17)
- Range of observed RDC values: -7.88, 26.44 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.452 seconds)

BMRB: 17961

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Entries sharing articles BMRB: 1 entries Detail

Related entities 1. U2U6111, : 1 entities Detail

Experiments performed 8 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 12 contents Detail