BMRBj - BMREntryMaster

Found 1 Document (0.4 seconds)

BMRB: 17972

2LK3

U2/U6 Helix I

Authors

Burke, J.E., Sashital, D.G., Zuo, X.E., Wang, Y., Butcher, S.E.

Assembly

U2/U6snRNA

Entity

1. U2/U6snRNA (polymer, Thiol state: not present), 24 monomers, 7779.633 Da Detail

GGCUUAGAUC AGAAAUGAUC AGCC

Formula weight

7779.633 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 100.0 %, Completeness: 56.9 %, Completeness (bb): 51.5 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	56.9 % (210 of 369)	62.8 % (130 of 207)	49.4 % (80 of 162)
Suger, PO4	51.5 % (136 of 264)	61.1 % (88 of 144)	40.0 % (48 of 120)
Nucleobase	70.5 % (74 of 105)	66.7 % (42 of 63)	76.2 % (32 of 42)
Aromatic	77.9 % (74 of 95)	79.2 % (42 of 53)	76.2 % (32 of 42)

1. RNA (5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')

GGCUUAGAUC AGAAAUGAUC AGCC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
1	RNA	natural abundance	0.5 ~ 0.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
6	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
7	H2O	natural abundance	90 %
8	D2O	natural abundance	10 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
11	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
12	Pf1 phage	natural abundance	17 mg/mL
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
15	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
16	Pf1 phage	natural abundance	17 mg/mL
17	D2O	natural abundance	100 %

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
18	RNA	natural abundance	0.5 ~ 0.6 mM
19	Pf1 phage	natural abundance	18 mg/mL
20	D2O	natural abundance	100 %

Chem. Shift Complete2

Sequence coverage: 79.2 %, Completeness: 32.0 %, Completeness (bb): 26.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	32.0 % (236 of 738)	37.7 % (156 of 414)	24.7 % (80 of 324)
Suger, PO4	26.9 % (142 of 528)	32.6 % (94 of 288)	20.0 % (48 of 240)
Nucleobase	44.8 % (94 of 210)	49.2 % (62 of 126)	38.1 % (32 of 84)
Aromatic	47.4 % (90 of 190)	54.7 % (58 of 106)	38.1 % (32 of 84)

1. RNA (5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')

GGCUUAGAUC AGAAAUGAUC AGCC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
1	RNA	natural abundance	0.5 ~ 0.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
6	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
7	H2O	natural abundance	90 %
8	D2O	natural abundance	10 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
11	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
12	Pf1 phage	natural abundance	17 mg/mL
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
15	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
16	Pf1 phage	natural abundance	17 mg/mL
17	D2O	natural abundance	100 %

Sample #7

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
18	RNA	natural abundance	0.5 ~ 0.6 mM
19	Pf1 phage	natural abundance	18 mg/mL
20	D2O	natural abundance	100 %

Release date

2012-02-19

Citation

Structure of the yeast U2/U6 snRNA complex
Burke, J.E., Sashital, D.G., Zuo, X., Wang, Y., Butcher, S.E.
RNA (2012), 18, 673-683, PubMed 22328579 , DOI 10.1261/rna.031138.111 , Abstract

Entries sharing articles BMRB: 1 entries Detail

BMRB: 17961 released on 2012-02-11
Title S. cerevisiae U2/U6 snRNA complex

Related entities 1. U2/U6snRNA, : 1 entities Detail

Experiments performed 14 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
1	RNA	natural abundance	0.5 ~ 0.6 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %

2 2D 1H-1H NOESY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

3 2D 1H-1H TOCSY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

4 2D 1H-13C HSQC aromatic

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

5 2D 1H-13C HSQC aliphatic

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
4	RNA	natural abundance		0.5 ~ 0.6 mM
5	D2O	natural abundance		100 %

6 2D 1H-15N HMQC

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
6	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
7	H2O	natural abundance	90 %
8	D2O	natural abundance	10 %

7 2D 1H-13C HSQC aromatic

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

8 2D 1H-13C HSQC aliphatic

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

9 2D 1H-15N HMQC

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
11	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
12	Pf1 phage	natural abundance	17 mg/mL
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

10 2D 1H-13C HSQC aromatic

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
15	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
16	Pf1 phage	natural abundance	17 mg/mL
17	D2O	natural abundance	100 %

11 2D 1H-13C HSQC aliphatic

Instrument

Varian INOVA - 600 MHz Jaulan

Sample

State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Concentration
15	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
16	Pf1 phage	natural abundance	17 mg/mL
17	D2O	natural abundance	100 %

12 2D HNN-COSY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 7.0 (±0.1)

#	Name	Isotope labeling	Concentration
6	RNA	[U-98% 13C; U-98% 15N]	0.3 mM
7	H2O	natural abundance	90 %
8	D2O	natural abundance	10 %

13 3D HCCH-TOCSY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

14 3D HCCH-COSY

Instrument

Bruker DMX - 750 MHz Telemark

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 7.0 (±.01)

#	Name	Isotope labeling	Type	Concentration
9	RNA	[U-98% 13C; U-98% 15N]		0.3 mM
10	D2O	natural abundance		100 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_17972_2lk3.nef
Input source #2: Coordindates	2lk3.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20----
GGCUUAGAUCAGAAAUGAUCAGCC
||||||||||||||||||||||||
GGCUUAGAUCAGAAAUGAUCAGCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	24	0	0	100.0

Content subtype: combined_17972_2lk3.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	210		100.0 (chain: A, length: 24)
2	Assigned chemical shifts	assigned_chem_shift_2ist_1	OK	37		79.2 (chain: A, length: 24)
1	Distance restraints	CNS/XPLOR_distance_constraints_6	Warning	255 (1)	noe	100.0 (chain: A, length: 24)
2	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	47 (1)	hbond	83.3 (chain: A, length: 24)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	92 (92)	.	75.0 (chain: A, length: 24)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	17 (17)	.	70.8 (chain: A, length: 24)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	32 (32)	.	66.7 (chain: A, length: 24)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 130
  - ¹³C chemical shifts: 80
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts
Saveframe: assigned_chem_shift_2ist_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 79.2%
- Total number of assignments
  - ¹H chemical shifts: 37
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	207	130	62.8
¹³C chemical shifts	162	80	49.4

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	144	88	61.1
¹³C chemical shifts	120	48	40.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	63	42	66.7
¹³C chemical shifts	42	32	76.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	22	100.0

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H22	8.235
1	G	H21	6.914
2	G	H22	8.447
2	G	H21	6.813
8	A	H62	7.784
8	A	H61	6.636
15	A	H62	7.842
17	G	H22	7.775
17	G	H21	6.002
21	A	H61	7.753
22	G	H21	8.354

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	207	26	12.6

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	144	6	4.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	63	20	31.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	4	18.2

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_6
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 100.0%
- Total number of restraints: 255
- Weight of restraints: 1.0 (255)
- Potential type of restraints: square-well-parabolic (255)
- Range of distance target values: 1.8, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_2
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 83.3%
  - Total number of restraints: 47
  - Weight of restraints: 1.0 (47)
  - Potential type of restraints: square-well-parabolic (47)
  - Range of distance target values: 1.89, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 75.0%
- Total number of restraints: 92
- Total number of restraints per polymer type: 92
- Weight of restraints: 1.0 (92)
- Potential type of restraints: square-well-parabolic (92)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_4
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 70.8%
  - Total number of restraints: 17
  - Total number of restraints per polymer type: 17
  - Weight of restraints: 1.0 (17)
  - Potential type of restraints: square-well-parabolic (17)
  - Dihedral angle restraints per residue
    - Chain_ID: A
  - Saveframe: CNS/XPLOR_dihedral_5
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 66.7%
    - Total number of restraints: 32
    - Total number of restraints per polymer type: 32
    - Weight of restraints: 1.0 (32)
    - Potential type of restraints: square-well-parabolic (32)
    - Dihedral angle restraints per residue
      - Chain_ID: A

Keywords bulge, U2 RNA, U6 RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.4 seconds)

BMRB: 17972

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Entries sharing articles BMRB: 1 entries Detail

Related entities 1. U2/U6snRNA, : 1 entities Detail

Experiments performed 14 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail