Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGACCCGGCUUACGCUGGGUCC
||||||||||||||||||||||
GGACCCGGCUUACGCUGGGUCC

Chain assignments

Content subtype: combined_18034_4a4t.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list
   • Status: OK
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     GGACCCGGCUUACGCUGGGUCC
     ||||||||||||||||||||||
     GGACCCGGCUUACGCUGGGUCC
     

   • Total number of assignments
     • ¹H chemical shifts: 89
   • Completeness of assignments
     • Entity_assemble_ID: A
       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	196	89	45.4

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	132	53	40.2

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	64	36	56.2

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	12	12	100.0

   • Histogram of normalized assigned chemical shifts

Dihedral angle restraints

1. Saveframe: CNS/XPLOR_dihedral_2
   • Status: OK
   • Experiment type: .
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     GGACCCGGCUUACGCUGGGUCC
     ||||||||||||||||||||||
     GGACCCGGCUUACGCUGGGUCC
     

   • Total number of restraints: 198
     • Gamma angle constraints: 18
     • Epsilon angle constraints: 21
     • Zeta angle constraints: 17
     • Chi angle constraints: 22
     • Nu0 angle constraints: 16
     • Nu1 angle constraints: 16
     • Nu2 angle constraints: 16
     • Nu3 angle constraints: 16
     • Nu4 angle constraints: 16
     • Alpha angle constraints: 17
     • Beta angle constraints: 17
     • Delta angle constraints: 6
   • Total number of restraints per polymer type: 198
     • Nucleic acid: 198
   • Weight of restraints: 1.0 (198)
     • Gamma angle constraints: 1.0 (18)
     • Epsilon angle constraints: 1.0 (21)
     • Zeta angle constraints: 1.0 (17)
     • Chi angle constraints: 1.0 (22)
     • Nu0 angle constraints: 1.0 (16)
     • Nu1 angle constraints: 1.0 (16)
     • Nu2 angle constraints: 1.0 (16)
     • Nu3 angle constraints: 1.0 (16)
     • Nu4 angle constraints: 1.0 (16)
     • Alpha angle constraints: 1.0 (17)
     • Beta angle constraints: 1.0 (17)
     • Delta angle constraints: 1.0 (6)
   • Potential type of restraints: square-well-parabolic (198)
     • Gamma angle constraints: square-well-parabolic (18)
     • Epsilon angle constraints: square-well-parabolic (21)
     • Zeta angle constraints: square-well-parabolic (17)
     • Chi angle constraints: square-well-parabolic (22)
     • Nu0 angle constraints: square-well-parabolic (16)
     • Nu1 angle constraints: square-well-parabolic (16)
     • Nu2 angle constraints: square-well-parabolic (16)
     • Nu3 angle constraints: square-well-parabolic (16)
     • Nu4 angle constraints: square-well-parabolic (16)
     • Alpha angle constraints: square-well-parabolic (17)
     • Beta angle constraints: square-well-parabolic (17)
     • Delta angle constraints: square-well-parabolic (6)
   • Dihedral angle restraints per residue
     • Chain_ID: A