Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGGATGGGACACAGGGGACGGG
||||||||||||||||||||||
GGGATGGGACACAGGGGACGGG

Chain assignments

Content subtype: combined_18209_2lod.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list_1
   • Status: Warning
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     GGGATGGGACACAGGGGACGGG
     ||||||||||||||||||||||
     GGGATGGGACACAGGGGACGGG
     

   • Total number of assignments
     • ¹H chemical shifts: 151
   • Completeness of assignments
     • Entity_assemble_ID: A
       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	205	151	73.7

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	154	113	73.4

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	51	38	74.5

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	1	1	100.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	23	18	78.3

   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: AMBER_distance_constraints_3
   • Status: OK
   • Experiment type: hbond
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 54.5%

     --------10--------20--
     GGGATGGGACACAGGGGACGGG
     |||  |||     |||   |||
     GGG..GGG.....GGG...GGG
     

   • Total number of restraints: 23
     • Total hydrogen bond restraints: 23
       • N...H-x: 4
       • O...H-x: 3
       • Long range: 16
         • O...H-x: 8
         • N...H-x: 8
   • Weight of restraints: 1.0 (23)
     • Total hydrogen bond restraints: 1.0 (23)
       • N...H-x: 1.0 (4)
       • O...H-x: 1.0 (3)
       • Long range: 1.0 (16)
         • O...H-x: 1.0 (8)
         • N...H-x: 1.0 (8)
   • Potential type of restraints: square-well-parabolic (23)
     • Total hydrogen bond restraints: square-well-parabolic (23)
       • N...H-x: square-well-parabolic (4)
       • O...H-x: square-well-parabolic (3)
       • Long range: square-well-parabolic (16)
         • O...H-x: square-well-parabolic (8)
         • N...H-x: square-well-parabolic (8)
   • Range of distance target values: 2.05, 2.25 (Å)
   • Histogram of distance target values
   • Distance restraints per residue
     • Chain_ID: A
   • Distance restraints on contact map
     • Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

1. Saveframe: AMBER_dihedral_4
   • Status: OK
   • Experiment type: .
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     GGGATGGGACACAGGGGACGGG
     ||||||||||||||||||||||
     GGGATGGGACACAGGGGACGGG
     

   • Total number of restraints: 68
     • Chi angle constraints: 23
     • Epsilon angle constraints: 22
     • Nu2 angle constraints: 23
   • Total number of restraints per polymer type: 68
     • Nucleic acid: 68
   • Weight of restraints: 1.0 (68)
     • Chi angle constraints: 1.0 (23)
     • Epsilon angle constraints: 1.0 (22)
     • Nu2 angle constraints: 1.0 (23)
   • Potential type of restraints: square-well-parabolic (68)
     • Chi angle constraints: square-well-parabolic (23)
     • Epsilon angle constraints: square-well-parabolic (22)
     • Nu2 angle constraints: square-well-parabolic (23)
   • Dihedral angle restraints per residue
     • Chain_ID: A