BMRBj - BMREntryMaster

Found 1 Document (0.352 seconds)

BMRB: 18279

2LPW

human CEB25 minisatellite G-quadruplex

Authors

Amrane, S., Adrian, M., Heddi, B., Serero, A., Nicolas, A., Mergny, J., Phan, A.

Assembly

human CEB25 minisatellite G-quadruplex

Entity

1. human CEB25 minisatellite G-quadruplex (polymer, Thiol state: not present), 26 monomers, 8338.277 Da Detail

AAGGGTGGGT GTAAGTGTGG GTGGGT

Formula weight

8338.277 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 91.4 %, Completeness (bb): 93.8 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H	³¹P
All	91.4 % (244 of 267)	90.9 % (219 of 241)	96.2 % (25 of 26)
Suger, PO4	93.8 % (195 of 208)	93.4 % (170 of 182)	96.2 % (25 of 26)
Nucleobase	83.1 % (49 of 59)	83.1 % (49 of 59)
Aromatic	80.8 % (42 of 52)	80.8 % (42 of 52)
Methyl	100.0 % (7 of 7)	100.0 % (7 of 7)

1. DNA (26-MER)

AAGGGTGGGT GTAAGTGTGG GTGGGT

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 7.00

#	Name	Isotope labeling	Concentration
1	DNA (26-MER)	natural abundance	0.2 ~ 2.0 mM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %

Release date

2012-03-21

Citation

Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite
Amrane, S., Adrian, M., Heddi, B., Serero, A., Nicolas, A., Mergny, J., Phan, A.
J. Am. Chem. Soc. (2012), 134, 5807-5816, PubMed 22376028 , DOI 10.1021/ja208993r , Abstract

Experiments performed 7 experiments Detail

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18279_2lpw.nef
Input source #2: Coordindates	2lpw.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20------
AAGGGTGGGTGTAAGTGTGGGTGGGT
||||||||||||||||||||||||||
AAGGGTGGGTGTAAGTGTGGGTGGGT

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	26	0	0	100.0

Content subtype: combined_18279_2lpw.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	300		100.0 (chain: A, length: 26)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	852 (1)	noe	100.0 (chain: A, length: 26)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	75 (1)	noe	61.5 (chain: A, length: 26)
3	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	11 (1)	noe	34.6 (chain: A, length: 26)
4	Distance restraints	CNS/XPLOR_distance_constraints_7	OK	52 (1)	hbond	53.8 (chain: A, length: 26)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	32 (32)	.	61.5 (chain: A, length: 26)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_6	OK	56 (56)	.	100.0 (chain: A, length: 26)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 100.0%

--------10--------20------
AAGGGTGGGTGTAAGTGTGGGTGGGT
||||||||||||||||||||||||||
AAGGGTGGGTGTAAGTGTGGGTGGGT

Total number of assignments
- ¹H chemical shifts: 219
- ¹³C chemical shifts: 56
- ³¹P chemical shifts: 25

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	DA	C1'	91.903
1	DA	C2	158.438
1	DA	C8	142.366
2	DA	C1'	86.663
2	DA	C2	158.36
2	DA	C8	139.996
2	DA	P	-0.389
3	DG	C1'	83.484
3	DG	C8	136.935
3	DG	P	0.827
4	DG	C1'	91.068
4	DG	C8	135.307
4	DG	P	-0.669
5	DG	C1'	86.044
5	DG	C8	136.469
5	DG	P	-1.109
6	DT	C1'	92.218
6	DT	C6	138.94
6	DT	P	-2.069
7	DG	C1'	90.856
7	DG	C8	136.049
7	DG	P	0.159
8	DG	C1'	82.519
8	DG	C8	136.934
8	DG	P	0.037
9	DG	C1'	85.85
9	DG	C8	136.241
9	DG	P	-0.476
10	DT	C1'	91.306
10	DT	C6	138.28
10	DT	P	-0.538
11	DG	C1'	88.318
11	DG	C8	139.249
11	DG	P	-0.476
12	DT	C1'	88.762
12	DT	C6	137.791
12	DT	P	-0.538
13	DA	C1'	87.134
13	DA	C2	159.328
13	DA	C8	141.67
13	DA	P	-0.669
14	DA	C1'	85.006
14	DA	C2	158.95
14	DA	C8	141.099
14	DA	P	-0.771
15	DG	C1'	85.083
15	DG	C8	137.721
15	DG	P	-0.669
16	DT	C1'	89.699
16	DT	C6	137.791
16	DT	P	-0.592
17	DG	C1'	87.54
17	DG	C8	138.84
17	DG	P	-0.476
18	DT	C1'	88.704
18	DT	C6	137.433
18	DT	P	0.259
19	DG	C1'	85.17
19	DG	C8	137.292
19	DG	P	0.444
20	DG	C1'	84.833
20	DG	C8	135.474
20	DG	P	-0.616
21	DG	C1'	86.106
21	DG	C8	136.532
21	DG	P	-1.05
22	DT	C1'	92.218
22	DT	C6	138.96
22	DT	P	-2.069
23	DG	C1'	83.498
23	DG	C8	135.75
23	DG	P	0.159
24	DG	C1'	82.166
24	DG	C8	136.934
24	DG	P	-0.024
25	DG	C1'	85.807
25	DG	C8	135.178
25	DG	P	-0.17
26	DT	C1'	89.312
26	DT	C6	137.183
26	DT	P	-0.538

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	241	219	90.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	182	170	93.4

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	59	49	83.1

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	7	7	100.0
¹³C chemical shifts	7	0	0.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	23	23	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 100.0%
- Total number of restraints: 852
- Weight of restraints: 1.0 (852)
- Potential type of restraints: square-well-parabolic (852)
- Range of distance target values: 2.7, 6.25 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 61.5%
  - Total number of restraints: 75
  - Weight of restraints: 1.0 (75)
  - Potential type of restraints: square-well-parabolic (75)
  - Range of distance target values: 4.0, 6.25 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_4
    - Status: OK
    - Experiment type: noe
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 34.6%
    - Total number of restraints: 11
    - Weight of restraints: 1.0 (11)
    - Potential type of restraints: square-well-parabolic (11)
    - Range of distance target values: 42.5, 42.5 (Å)
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map
    - Saveframe: CNS/XPLOR_distance_constraints_7
      - Status: OK
      - Experiment type: hbond
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 53.8%
        --------10--------20------ AAGGGTGGGTGTAAGTGTGGGTGGGT |||| ||| |||| ||| .AGGG.GGG........TGGG.GGG --------10--------20-----
      - Total number of restraints: 52
        Total hydrogen bond restraints: 52
        N...H-x: 6
        N...h_N: 6
        O...H-x: 6
        O...h-N: 6
        Long range: 28
        N...h_N: 7
        N...H-x: 7
        O...h-N: 7
        O...H-x: 7
      - Weight of restraints: 1.0 (52)
        Total hydrogen bond restraints: 1.0 (52)
        N...H-x: 1.0 (6)
        N...h_N: 1.0 (6)
        O...H-x: 1.0 (6)
        O...h-N: 1.0 (6)
        Long range: 1.0 (28)
        N...h_N: 1.0 (7)
        N...H-x: 1.0 (7)
        O...h-N: 1.0 (7)
        O...H-x: 1.0 (7)
      - Potential type of restraints: square-well-parabolic (52)
        Total hydrogen bond restraints: square-well-parabolic (52)
        N...H-x: square-well-parabolic (6)
        N...h_N: square-well-parabolic (6)
        O...H-x: square-well-parabolic (6)
        O...h-N: square-well-parabolic (6)
        Long range: square-well-parabolic (28)
        N...h_N: square-well-parabolic (7)
        N...H-x: square-well-parabolic (7)
        O...h-N: square-well-parabolic (7)
        O...H-x: square-well-parabolic (7)
      - Range of distance target values: 1.95, 3.0 (Å)
      - Histogram of distance target values
      - Distance restraints per residue
        Chain_ID: A
      - Distance restraints on contact map
        Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 61.5%
- Total number of restraints: 32
- Total number of restraints per polymer type: 32
- Weight of restraints: 1.0 (32)
- Potential type of restraints: square-well-parabolic (32)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_6
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 100.0%
- Total number of restraints: 56
- Potential type of restraints: undefined (56)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords G-quadruplex, human minisatellite

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.352 seconds)

BMRB: 18279

Sample

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail