BMRBj - BMREntryMaster

Found 1 Document (0.334 seconds)

BMRB: 18336

2LQZ

Structure of the RNA claw of the DNA packaging motor of bacteriophage 29

Authors

Harjes, E.J., Matsuo, H.J., Kitamura, A.J.

Assembly

RNA (27-MER)

Entity

1. RNA (27-MER) (polymer, Thiol state: not present), 27 monomers, 8649.098 Da Detail

GGACUUCCAU UGCUUCGGCA AAAGUCC

Formula weight

8649.098 Da

Source organism

Staphylococcus virus 29

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 63.4 %, Completeness (bb): 53.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	63.4 % (276 of 435)	85.8 % (205 of 239)	37.7 % (69 of 183)	15.4 % (2 of 13)
Suger, PO4	53.2 % (158 of 297)	82.7 % (134 of 162)	17.8 % (24 of 135)
Nucleobase	85.5 % (118 of 138)	92.2 % (71 of 77)	93.8 % (45 of 48)	15.4 % (2 of 13)
Aromatic	86.9 % (106 of 122)	96.7 % (59 of 61)	93.8 % (45 of 48)	15.4 % (2 of 13)

1. RNA (27-MER)

GGACUUCCAU UGCUUCGGCA AAAGUCC

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.5

#	Name	Isotope labeling	Concentration
1	RNA (27-MER)	[U-100% 13C; U-100% 15N]	300 uM
2	H2O	natural abundance	90 %
3	D2O	natural abundance	10 %

Release date

2012-07-29

Citation

Structure of the RNA claw of the DNA packaging motor of bacteriophage Φ29
Harjes, E., Kitamura, A., Zhao, W., Morais, M.C., Jardine, P.J., Grimes, S., Matsuo, H.
Nucleic Acids Res. (2012), 40, 9953-9963, PubMed 22879380 , DOI 10.1093/nar/gks724 , Abstract

Related entities 1. RNA (27-MER), : 1 entities Detail

Experiments performed 5 experiments Detail

NMR combined restraints 10 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18336_2lqz.nef
Input source #2: Coordindates	2lqz.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-------
GGACUUCCAUUGCUUCGGCAAAAGUCC
|||||||||||||||||||||||||||
GGACUUCCAUUGCUUCGGCAAAAGUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_18336_2lqz.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	287		100.0 (chain: A, length: 27)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	426 (1)	noe	100.0 (chain: A, length: 27)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	42 (1)	hbond	59.3 (chain: A, length: 27)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_9	Warning	187 (187)	.	92.6 (chain: A, length: 27)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_4	OK	18 (18)	.	66.7 (chain: A, length: 27)
2	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	28 (28)	.	70.4 (chain: A, length: 27)
3	RDC restraints	CNS/XPLOR_dipolar_coupling_8	Warning	6 (6)	.	22.2 (chain: A, length: 27)
4	RDC restraints	CNS/XPLOR_dipolar_coupling_6	Warning	5 (5)	.	18.5 (chain: A, length: 27)
5	RDC restraints	CNS/XPLOR_dipolar_coupling_7	Warning	7 (7)	.	25.9 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 209
  - ¹³C chemical shifts: 69
  - ¹⁵N chemical shifts: 9
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H22	6.67
5	U	N1	190.487
6	U	N1	190.863
10	U	N1	190.838
11	U	N1	190.712
14	U	N1	191.977
15	U	N1	188.771
18	G	H21	8.7
18	G	H22	6.4
24	G	H21	8.67
25	U	N1	192.14

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	239	205	85.8
¹³C chemical shifts	183	69	37.7
¹⁵N chemical shifts	13	2	15.4

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	162	134	82.7
¹³C chemical shifts	135	24	17.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	77	71	92.2
¹³C chemical shifts	48	45	93.8
¹⁵N chemical shifts	13	2	15.4

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	18	18	100.0
¹³C chemical shifts	18	17	94.4

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%
- Total number of restraints: 426
- Weight of restraints: 1.0 (426)
- Potential type of restraints: square-well-parabolic (426)
- Range of distance target values: 2.15, 5.0 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 59.3%
  - Total number of restraints: 42
  - Weight of restraints: 1.0 (42)
  - Potential type of restraints: square-well-parabolic (42)
  - Range of distance target values: 2.05, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_9
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 92.6%
- Total number of restraints: 187
- Total number of restraints per polymer type: 187
- Weight of restraints: 1.0 (187)
- Potential type of restraints: square-well-parabolic (187)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 66.7%
- Total number of restraints: 18
- Potential type of restraints: undefined (18)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None
- Saveframe: CNS/XPLOR_dipolar_coupling_5
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 70.4%
  - Total number of restraints: 28
  - Potential type of restraints: undefined (28)
  - Range of observed RDC values: 100.0, -100.0 (Hz)
  - RDC restraints per residue
    - Chain_ID: A
      None
  - Saveframe: CNS/XPLOR_dipolar_coupling_8
    - Status: Warning
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 22.2%
    - Total number of restraints: 6
    - Potential type of restraints: undefined (6)
    - Range of observed RDC values: 100.0, -100.0 (Hz)
    - RDC restraints per residue
    - Saveframe: CNS/XPLOR_dipolar_coupling_6
      - Status: Warning
      - Experiment type: .
      - Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 18.5%
      - Total number of restraints: 5
        H1'-C1' bond vectors: 5
      - Potential type of restraints: undefined (5)
        H1'-C1' bond vectors: undefined (5)
      - Range of observed RDC values: 100.0, -100.0 (Hz)
      - RDC restraints per residue
      - Saveframe: CNS/XPLOR_dipolar_coupling_7
        Status: Warning
        Experiment type: .
        Sequence coverage of experimental data
        Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 25.9%
        Total number of restraints: 7
        H3-N3 bond vectors: 1
        H1-N1 bond vectors: 6
        Potential type of restraints: undefined (7)
        H3-N3 bond vectors: undefined (1)
        H1-N1 bond vectors: undefined (6)
        Range of observed RDC values: 100.0, -100.0 (Hz)
        RDC restraints per residue

Keywords bulge, RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.334 seconds)

BMRB: 18336

Sample

Related entities 1. RNA (27-MER), : 1 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 10 contents Detail