BMRBj - BMREntryMaster

Found 1 Document (0.351 seconds)

BMRB: 18549

2LV0

Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA

Authors

Nikonowicz, E.P., Wang, J., Moran, S., Donarski, J.

Assembly

Helix-35 Stem-loop from E. coli 23S rRNA

Entity

1. Helix-35 Stem-loop from E. coli 23S rRNA (polymer, Thiol state: not present), 24 monomers, 7780.617 Da Detail

GGGCUAAUGU UGAAAAAUUA GCCC

Formula weight

7780.617 Da

Source organism

Escherichia coli

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 91.1 %, Completeness (bb): 99.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	91.1 % (346 of 380)	89.8 % (185 of 206)	99.4 % (161 of 162)	0.0 % (0 of 12)
Suger, PO4	99.2 % (262 of 264)	99.3 % (143 of 144)	99.2 % (119 of 120)
Nucleobase	72.4 % (84 of 116)	67.7 % (42 of 62)	100.0 % (42 of 42)	0.0 % (0 of 12)
Aromatic	77.8 % (84 of 108)	77.8 % (42 of 54)	100.0 % (42 of 42)	0.0 % (0 of 12)

1. RNA

GGGCUAAUGU UGAAAAAUUA GCCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA	natural abundance	1.6 (±0.1) mM
7	potassium phosphate	natural abundance	10 (±1.0) mM
8	sodium chloride	natural abundance	10 (±1.0) mM
9	EDTA	natural abundance	0.1 (±0.5) mM
10	D2O	natural abundance	100 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
11	RNA	natural abundance	1.6 (±0.1) mM
12	potassium phosphate	natural abundance	10 (±1.0) mM
13	sodium chloride	natural abundance	10 (±1.0) mM
14	EDTA	natural abundance	0.1 (±0.5) mM
15	D2O	natural abundance	10 %
16	H2O	natural abundance	90 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
18	potassium phosphate	natural abundance	10 (±1.0) mM
19	sodium chloride	natural abundance	10 (±1.0) mM
20	EDTA	natural abundance	0.1 (±0.5) mM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

Release date

2013-06-23

Citation

Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA
Moran, S., Donarski, J., Wang, J., Nikonowicz, E.P.
Not known

Related entities 1. Helix-35 Stem-loop from E. coli 23S rRNA, : 1 : 1 entities Detail

Experiments performed 13 experiments Detail

1 2D 1H-15N HSQC

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
18	potassium phosphate	natural abundance	10 (±1.0) mM
19	sodium chloride	natural abundance	10 (±1.0) mM
20	EDTA	natural abundance	0.1 (±0.5) mM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

2 2D 1H-13C HSQC

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

3 3D HCCH-TOCSY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

4 3D 1H-13C NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

5 2D 1H-1H NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA	natural abundance	1.6 (±0.1) mM
7	potassium phosphate	natural abundance	10 (±1.0) mM
8	sodium chloride	natural abundance	10 (±1.0) mM
9	EDTA	natural abundance	0.1 (±0.5) mM
10	D2O	natural abundance	100 %

6 2D DQF-COSY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA	natural abundance	1.6 (±0.1) mM
7	potassium phosphate	natural abundance	10 (±1.0) mM
8	sodium chloride	natural abundance	10 (±1.0) mM
9	EDTA	natural abundance	0.1 (±0.5) mM
10	D2O	natural abundance	100 %

7 2D 1H-1H NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.8

#	Name	Isotope labeling	Concentration
11	RNA	natural abundance	1.6 (±0.1) mM
12	potassium phosphate	natural abundance	10 (±1.0) mM
13	sodium chloride	natural abundance	10 (±1.0) mM
14	EDTA	natural abundance	0.1 (±0.5) mM
15	D2O	natural abundance	10 %
16	H2O	natural abundance	90 %

8 3D HCCH-COSY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

9 2D 1H-31P HetCor

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA	natural abundance	1.6 (±0.1) mM
7	potassium phosphate	natural abundance	10 (±1.0) mM
8	sodium chloride	natural abundance	10 (±1.0) mM
9	EDTA	natural abundance	0.1 (±0.5) mM
10	D2O	natural abundance	100 %

10 2D 1H-15N HMQC

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

11 2D 1H-13C ctHSQC-31P

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

12 2D 1H-15N HCN

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
2	potassium phosphate	natural abundance	10 (±1.0) mM
3	sodium chloride	natural abundance	10 (±1.0) mM
4	EDTA	natural abundance	0.1 (±0.5) mM
5	D2O	natural abundance	100 %

13 3D 1H-15N NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA	[U-99% 13C; U-99% 15N]	1.2 (±0.1) mM
18	potassium phosphate	natural abundance	10 (±1.0) mM
19	sodium chloride	natural abundance	10 (±1.0) mM
20	EDTA	natural abundance	0.1 (±0.5) mM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_18549_2lv0.nef
Input source #2: Coordindates	2lv0.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20----
GGGCUAAUGUUGAAAAAUUAGCCC
||||||||||||||||||||||||
GGGCUAAUGUUGAAAAAUUAGCCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	24	0	0	100.0

Content subtype: combined_18549_2lv0.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	D2Ochemshifts	OK	408		100.0 (chain: A, length: 24)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	345 (1)	noe	100.0 (chain: A, length: 24)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	152 (152)	.	100.0 (chain: A, length: 24)

Assigned chemical shifts

Saveframe: D2Ochemshifts

Status: OK
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 185
- ¹³C chemical shifts: 181
- ¹⁵N chemical shifts: 42

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	N7	234.68
2	G	N9	170.65
3	G	N7	234.99
3	G	N9	170.13
4	C	C2	159.0
4	C	C4	168.47
5	U	C2	152.51
5	U	C4	169.44
6	A	N1	222.05
6	A	N3	212.98
6	A	N7	231.71
6	A	N9	171.25
7	A	N1	222.74
7	A	N3	213.59
7	A	N7	231.55
7	A	N9	171.95
8	U	C2	152.38
8	U	C4	167.99
9	G	N7	237.8
9	G	N9	169.52
10	U	C2	153.55
10	U	C4	167.45
11	U	C2	153.83
11	U	C4	168.4
12	G	N7	236.09
12	G	N9	168.61
13	A	N1	226.39
13	A	N3	217.75
13	A	N7	231.24
13	A	N9	169.91
14	A	N1	226.0
14	A	N3	217.1
14	A	N7	232.34
14	A	N9	169.26
15	A	N1	225.91
15	A	N3	217.12
15	A	N7	232.8
15	A	N9	169.39
16	A	N1	224.43
16	A	N3	216.89
16	A	N7	233.12
16	A	N9	169.67
17	A	N1	224.26
17	A	N3	215.06
17	A	N7	231.4
17	A	N9	169.43
18	U	C2	152.43
18	U	C4	169.13
19	U	C2	152.71
19	U	C4	168.49
20	A	N1	221.88
20	A	N3	212.68
20	A	N7	231.7
20	A	N9	171.56
21	G	N7	235.03
21	G	N9	170.17
22	C	C2	158.81
22	C	C4	168.08
23	C	C2	158.97
23	C	C4	168.52
24	C	C2	159.89
24	C	C4	168.79

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	206	185	89.8
¹³C chemical shifts	162	161	99.4
¹⁵N chemical shifts	12	0	0.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	144	143	99.3
¹³C chemical shifts	120	119	99.2

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	62	42	67.7
¹³C chemical shifts	42	42	100.0
¹⁵N chemical shifts	12	0	0.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	22	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 100.0%
- Total number of restraints: 345
- Weight of restraints: 1.0 (345)
- Potential type of restraints: square-well-parabolic (345)
- Range of distance target values: 1.75, 6.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 24, Sequence coverage: 100.0%
- Total number of restraints: 152
- Total number of restraints per polymer type: 152
- Weight of restraints: 1.0 (152)
- Potential type of restraints: square-well-parabolic (152)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords 23S rRNA, erythromycin resistance, methylation, ribosome

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.351 seconds)

BMRB: 18549

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. Helix-35 Stem-loop from E. coli 23S rRNA, : 1 : 1 entities Detail

Experiments performed 13 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 4 contents Detail