BMRBj - BMREntryMaster

Found 1 Document (0.363 seconds)

BMRB: 18633

2LWK

solution structure of small molecule-influenza RNA complex, Seattle Structural Genomics Center for Infectious Disease (SSGCID)

Authors

Lee, M.K., Varani, G., Choi, B.S., Pellecchia, M.

Assembly

small molecule-influenza RNA complex

Entity

1. influenza A virus RNA promoter (polymer, Thiol state: not present), 32 monomers, 10321.07 Da Detail

GAGUAGAAAC AAGGCUUCGG CCUGCUUUUG CU

2. 6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine (non-polymer), 289.333 Da

Total weight

10610.403 Da

Max. entity weight

10321.07 Da

Source organism

Influenza A virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 66.7 %, Completeness (bb): 68.8 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	66.7 % (186 of 279)	66.7 % (186 of 279)
Suger, PO4	68.8 % (132 of 192)	68.8 % (132 of 192)
Nucleobase	62.1 % (54 of 87)	62.1 % (54 of 87)
Aromatic	74.0 % (54 of 73)	74.0 % (54 of 73)

1. influenza A virus RNA promoter

GAGUAGAAAC AAGGCUUCGG CCUGCUUUUG CU

Show sample condition

Sample #1

Solvent system 90% H2O, 10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.0, Details 20mM phosphate buffer

#	Name	Isotope labeling	Concentration
1	influenza A virus RNA promoter	natural abundance	1 mM
2	sodium chloride	natural abundance	50 mM
3	phosphate buffer	natural abundance	20 mM
4	D2O	natural abundance	10 %
5	H2O	natural abundance	90 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.0, Details 20mM phosphate buffer

#	Name	Isotope labeling	Concentration
6	influenza A virus RNA promoter	natural abundance	1 mM
7	sodium chloride	natural abundance	50 mM
8	phosphate buffer	natural abundance	20 mM
9	D2O	natural abundance	100 %

Release date

2013-02-13

Citation

A novel small-molecule binds to the influenza A virus RNA promoter and inhibits viral replication
Lee, M., Bottini, A., Kim, M., Bardaro, M.F., Zhang, Z., Pellecchia, M., Choi, B., Varani, G.
Chem. Commun. (Camb). (2014), 50, 368-370, PubMed 24247110 , DOI 10.1039/c3cc46973e , Abstract

Related entities 1. influenza A virus RNA promoter, : 1 : 2 : 5 entities Detail

Experiments performed 2 experiments Detail

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_18633_2lwk.nef
Input source #2: Coordindates	2lwk.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	0EC	6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine	None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--
GAGUAGAAACAAGGCUUCGGCCUGCUUUUGCU
||||||||||||||||||||||||||||||||
GAGUAGAAACAAGGCUUCGGCCUGCUUUUGCU

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	32	0	0	100.0

Content subtype: combined_18633_2lwk.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	186		100.0 (chain: A, length: 32)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	409 (1)	noe	100.0 (chain: A, length: 32)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	42 (1)	hbond	56.2 (chain: A, length: 32)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	242 (242)	.	100.0 (chain: A, length: 32)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 186
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	279	186	66.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	192	132	68.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	87	54	62.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	23	22	95.7

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 409
- Weight of restraints: 1.0 (409)
- Potential type of restraints: square-well-parabolic (409)
- Range of distance target values: 2.5, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 56.2%
  - Total number of restraints: 42
  - Weight of restraints: 1.0 (42)
  - Potential type of restraints: square-well-parabolic (42)
  - Range of distance target values: 1.73, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
      None
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 242
- Total number of restraints per polymer type: 242
- Weight of restraints: 1.0 (242)
- Potential type of restraints: square-well-parabolic (242)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords double helix

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB