BMRBj - BMREntryMaster

Found 1 Document (0.406 seconds)

BMRB: 18892

2M22

Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA

Authors

Cash, D.D., Richards, R.J., Theimer, C.A., Finger, D.L., Feigon, J.

Assembly

helix II template boundary element from Tetrahymena telomerase RNA

Entity

1. helix II template boundary element from Tetrahymena telomerase RNA (polymer, Thiol state: not present), 23 monomers, 7450.427 Da Detail

GGCAGAUCUG UAAUAGAACU GCC

Formula weight

7450.427 Da

Source organism

Tetrahymena thermophila

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 94.2 %, Completeness (bb): 97.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	94.2 % (344 of 365)	92.5 % (184 of 199)	97.4 % (151 of 155)	81.8 % (9 of 11)
Suger, PO4	97.2 % (246 of 253)	97.8 % (135 of 138)	96.5 % (111 of 115)
Nucleobase	87.5 % (98 of 112)	80.3 % (49 of 61)	100.0 % (40 of 40)	81.8 % (9 of 11)
Aromatic	96.1 % (98 of 102)	96.1 % (49 of 51)	100.0 % (40 of 40)	81.8 % (9 of 11)

1. helixII telo RNA

GGCAGAUCUG UAAUAGAACU GCC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	helixII_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	sodium phosphate	natural abundance	10 mM
3	potassium chloride	natural abundance	30 mM
4	EDTA	natural abundance	50 uM
5	sodium azide	natural abundance	0.2 %
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

Sample #2

Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	helixII_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	30 mM
11	EDTA	natural abundance	50 uM
12	sodium azide	natural abundance	0.2 %
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

Release date

2013-01-23

Citation

Structure of the Tetrahymena thermophila telomerase RNA helix II template boundary element
Richards, R.J., Theimer, C.A., Finger, D.L., Feigon, J.
Nucleic Acids Res. (2006), 34, 816-825, PubMed 16452301 , DOI 10.1093/nar/gkj481 , Abstract

Related entities 1. helix II template boundary element from Tetrahymena telomerase RNA, : 1 entities Detail

Experiments performed 7 experiments Detail

1 11echo and watergate

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	helixII_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	sodium phosphate	natural abundance	10 mM
3	potassium chloride	natural abundance	30 mM
4	EDTA	natural abundance	50 uM
5	sodium azide	natural abundance	0.2 %
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

2 2D TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	helixII_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	sodium phosphate	natural abundance	10 mM
3	potassium chloride	natural abundance	30 mM
4	EDTA	natural abundance	50 uM
5	sodium azide	natural abundance	0.2 %
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

3 2D NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
1	helixII_telo_RNA	unlabeled	0.6 ~ 1.0 mM
2	sodium phosphate	natural abundance	10 mM
3	potassium chloride	natural abundance	30 mM
4	EDTA	natural abundance	50 uM
5	sodium azide	natural abundance	0.2 %
6	H2O	natural abundance	90 %
7	D2O	natural abundance	10 %

4 2D 15N-HMQC, 2D 15N-CPMG-NOESY, 2D JNN-HNN-COSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	helixII_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	30 mM
11	EDTA	natural abundance	50 uM
12	sodium azide	natural abundance	0.2 %
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

5 2D 13C-HSQCs

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	helixII_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	30 mM
11	EDTA	natural abundance	50 uM
12	sodium azide	natural abundance	0.2 %
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

6 2D HCCH COSY, 3D HCCH-TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	helixII_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	30 mM
11	EDTA	natural abundance	50 uM
12	sodium azide	natural abundance	0.2 %
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

7 3D 1H,13C HMQCs

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O or 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.3

#	Name	Isotope labeling	Concentration
8	helixII_telo_RNA	13C,15N uniformly labelled	0.6 ~ 1.0 mM
9	sodium phosphate	natural abundance	10 mM
10	potassium chloride	natural abundance	30 mM
11	EDTA	natural abundance	50 uM
12	sodium azide	natural abundance	0.2 %
13	H2O	natural abundance	90 %
14	D2O	natural abundance	10 %

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18892_2m22.nef
Input source #2: Coordindates	2m22.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---
GGCAGAUCUGUAAUAGAACUGCC
|||||||||||||||||||||||
GGCAGAUCUGUAAUAGAACUGCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	23	0	0	100.0

Content subtype: combined_18892_2m22.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	369		100.0 (chain: A, length: 23)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	518 (1)	noe	100.0 (chain: A, length: 23)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	42 (1)	hbond	69.6 (chain: A, length: 23)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	164 (164)	.	100.0 (chain: A, length: 23)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	63 (63)	.	100.0 (chain: A, length: 23)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: OK
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 184
- ¹³C chemical shifts: 151
- ¹⁵N chemical shifts: 34

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
3	C	N4	97.744
4	A	N1	213.002
4	A	N3	219.714
4	A	N6	82.137
5	G	N2	73.51
6	A	N1	212.627
6	A	N3	229.202
8	C	N4	97.279
12	A	N1	215.927
12	A	N3	223.315
13	A	N1	216.677
13	A	N3	226.09
15	A	N1	213.489
15	A	N3	220.614
15	A	N6	78.619
16	G	N2	74.074
17	A	N1	210.977
17	A	N3	221.927
17	A	N6	82.79
18	A	N1	212.027
18	A	N3	231.077
18	A	N6	80.389
19	C	N4	96.376
21	G	N2	74.544
22	C	N4	98.897

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	199	184	92.5
¹³C chemical shifts	155	151	97.4
¹⁵N chemical shifts	11	9	81.8

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	138	135	97.8
¹³C chemical shifts	115	111	96.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	61	49	80.3
¹³C chemical shifts	40	40	100.0
¹⁵N chemical shifts	11	9	81.8

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	20	20	100.0
¹³C chemical shifts	20	20	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
- Total number of restraints: 518
- Weight of restraints: 1.0 (518)
- Potential type of restraints: square-well-parabolic (518)
- Range of distance target values: 2.15, 5.75 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 69.6%
  - Total number of restraints: 42
  - Weight of restraints: 1.0 (42)
  - Potential type of restraints: square-well-parabolic (42)
  - Range of distance target values: 2.0, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
- Total number of restraints: 164
- Total number of restraints per polymer type: 164
- Weight of restraints: 1.0 (164)
- Potential type of restraints: square-well-parabolic (164)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
- Total number of restraints: 63
- Potential type of restraints: square-well-parabolic (63)
- Range of observed RDC values: -35.45, 28.26 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords biomolecular, ciliate, genetic, holoenzyme, Models, Molecular, nuclear magnetic resonance, nucleic acid, protein, protozoan proteins, reverse transcriptase, RNA, secondary, structure, telomerase, template, tertiary, tetrahymena thermophila

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.406 seconds)

BMRB: 18892

Sample #1

Sample #2

Related entities 1. helix II template boundary element from Tetrahymena telomerase RNA, : 1 entities Detail

Experiments performed 7 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail