BMRBj - BMREntryMaster

Found 1 Document (0.352 seconds)

BMRB: 18893

2M23

NMR solution structure of the d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1

Authors

Kruschel, D., Skilandat, M., Sigel, R.K. O.

Assembly

d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1

Entity

1. RNA (29-MER) (polymer, Thiol state: not present), 29 monomers, 9364.517 Da Detail

GGAGUAUGUA UUGGCACUGA GCAUACUCC

2. RNA (7-MER) (polymer, Thiol state: not present), 7 monomers, 2260.327 Da Detail

CAGUGUC

Total weight

11624.844 Da

Max. entity weight

9364.517 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 63.7 %, Completeness (bb): 52.5 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	63.7 % (367 of 576)	87.9 % (276 of 314)	32.2 % (78 of 242)	65.0 % (13 of 20)
Suger, PO4	52.5 % (208 of 396)	83.3 % (180 of 216)	15.6 % (28 of 180)
Nucleobase	88.3 % (159 of 180)	98.0 % (96 of 98)	80.6 % (50 of 62)	65.0 % (13 of 20)
Aromatic	87.2 % (143 of 164)	97.6 % (80 of 82)	80.6 % (50 of 62)	65.0 % (13 of 20)

1. RNA (29-MER)

GGAGUAUGUA UUGGCACUGA GCAUACUCC

2. RNA (7-MER)

CAGUGUC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
2	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
3	potassium chloride	natural abundance	110 mM
4	EDTA	natural abundance	10 uM
5	D2O	natural abundance	100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
6	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
7	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
8	potassium chloride	natural abundance	110 mM
9	EDTA	natural abundance	10 uM
10	D2O	natural abundance	10 %
11	H2O	natural abundance	90 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
12	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
13	RNA_(7-MER)	natural abundance	0.5 mM
14	potassium chloride	natural abundance	110 mM
15	EDTA	natural abundance	10 uM
16	D2O	natural abundance	100 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
23	RNA (29-MER)	[3',4',5',5'',5-100% 2H]	0.6 mM
24	RNA_(7-MER)	natural abundance	0.6 mM
25	potassium chloride	natural abundance	110 mM
26	EDTA	natural abundance	10 uM
27	D2O	natural abundance	100 %

Sample #6

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
28	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
29	RNA_(7-MER)	natural abundance	0.5 mM
30	potassium chloride	natural abundance	110 mM
31	EDTA	natural abundance	10 uM
32	Pf1 phage	natural abundance	25.6 mg/mL
33	D2O	natural abundance	10 %
34	H2O	natural abundance	90 %

Release date

2013-12-15

Citation

NMR structure of the 5' splice site in the group IIB intron Sc.ai5γ--conformational requirements for exon-intron recognition
Kruschel, D., Skilandat, M., Sigel, R.K.O.
RNA (2014), 20, 295-307, PubMed 24448450 , DOI 10.1261/rna.041137.113 , Abstract

Related entities 1. RNA (29-MER), : 1 : 2 entities Detail

Experiments performed 18 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
2	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
3	potassium chloride	natural abundance	110 mM
4	EDTA	natural abundance	10 uM
5	D2O	natural abundance	100 %

2 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI z-axis gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
2	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
3	potassium chloride	natural abundance	110 mM
4	EDTA	natural abundance	10 uM
5	D2O	natural abundance	100 %

3 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
2	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
3	potassium chloride	natural abundance	110 mM
4	EDTA	natural abundance	10 uM
5	D2O	natural abundance	100 %

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
23	RNA (29-MER)	[3',4',5',5'',5-100% 2H]	0.6 mM
24	RNA_(7-MER)	natural abundance	0.6 mM
25	potassium chloride	natural abundance	110 mM
26	EDTA	natural abundance	10 uM
27	D2O	natural abundance	100 %

5 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

6 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
28	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
29	RNA_(7-MER)	natural abundance	0.5 mM
30	potassium chloride	natural abundance	110 mM
31	EDTA	natural abundance	10 uM
32	Pf1 phage	natural abundance	25.6 mg/mL
33	D2O	natural abundance	10 %
34	H2O	natural abundance	90 %

7 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

8 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

9 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
28	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
29	RNA_(7-MER)	natural abundance	0.5 mM
30	potassium chloride	natural abundance	110 mM
31	EDTA	natural abundance	10 uM
32	Pf1 phage	natural abundance	25.6 mg/mL
33	D2O	natural abundance	10 %
34	H2O	natural abundance	90 %

10 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
12	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
13	RNA_(7-MER)	natural abundance	0.5 mM
14	potassium chloride	natural abundance	110 mM
15	EDTA	natural abundance	10 uM
16	D2O	natural abundance	100 %

11 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
12	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
13	RNA_(7-MER)	natural abundance	0.5 mM
14	potassium chloride	natural abundance	110 mM
15	EDTA	natural abundance	10 uM
16	D2O	natural abundance	100 %

12 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
7	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
8	potassium chloride	natural abundance	110 mM
9	EDTA	natural abundance	10 uM
10	D2O	natural abundance	10 %
11	H2O	natural abundance	90 %

13 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI z-axis gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
7	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
8	potassium chloride	natural abundance	110 mM
9	EDTA	natural abundance	10 uM
10	D2O	natural abundance	10 %
11	H2O	natural abundance	90 %

14 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K, pH 6.8

#	Name	Isotope labeling	Concentration
6	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
7	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
8	potassium chloride	natural abundance	110 mM
9	EDTA	natural abundance	10 uM
10	D2O	natural abundance	10 %
11	H2O	natural abundance	90 %

15 2D JNN HNN COSY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

16 1D-31P

Instrument

Bruker Avance - 500 MHz Cryo QNP, z-axis gradient probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.5 ~ 0.9 mM
2	RNA_(7-MER)	natural abundance	0.5 ~ 0.9 mM
3	potassium chloride	natural abundance	110 mM
4	EDTA	natural abundance	10 uM
5	D2O	natural abundance	100 %

17 F1,2 X-filtered 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

18 F1,2 X-filtered 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
17	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.5 mM
18	RNA_(7-MER)	natural abundance	0.5 mM
19	potassium chloride	natural abundance	110 mM
20	EDTA	natural abundance	10 uM
21	D2O	natural abundance	10 %
22	H2O	natural abundance	90 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18893_2m23.nef
Input source #2: Coordindates	2m23.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---------
GGAGUAUGUAUUGGCACUGAGCAUACUCC
|||||||||||||||||||||||||||||
GGAGUAUGUAUUGGCACUGAGCAUACUCC

Entity_assembly_ID (NMR): B vs Auth_asym_ID (model): B

-60----
CAGUGUC
|||||||
CAGUGUC
-------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	29	0	0	100.0
B	B	7	0	0	100.0

Content subtype: combined_18893_2m23.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	397		100.0 (chain: A, length: 29), 100.0 (chain: B, length: 7)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	747 (1)	noe	100.0 (chain: A, length: 29), 100.0 (chain: B, length: 7)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	82 (1)	hbond	86.2 (chain: A, length: 29), 100.0 (chain: B, length: 7)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	150 (150)	.	100.0 (chain: A, length: 29), 100.0 (chain: B, length: 7)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	96 (96)	.	89.7 (chain: A, length: 29), 85.7 (chain: B, length: 7)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_6	OK	36 (36)	.	100.0 (chain: A, length: 29), 100.0 (chain: B, length: 7)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_7	OK	20 (20)	.	62.1 (chain: A, length: 29)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
- Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 306
- ¹³C chemical shifts: 78
- ¹⁵N chemical shifts: 13

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H21	7.821
2	G	H22	5.679
3	A	H61	8.03
3	A	H62	6.64
4	G	H21	7.494
4	G	H22	6.09
6	A	H61	7.53
6	A	H62	6.125
8	G	H21	7.483
8	G	H22	5.603
10	A	H61	7.739
10	A	H62	5.091
14	G	H21	7.984
14	G	H22	5.936
19	G	H21	7.383
19	G	H22	5.582
20	A	H61	7.321
20	A	H62	5.224
21	G	H21	7.48
21	G	H22	5.69
23	A	H61	7.546
23	A	H62	6.114
25	A	H61	7.564
25	A	H62	6.103

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	252	218	86.5
¹³C chemical shifts	195	78	40.0
¹⁵N chemical shifts	16	13	81.2

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	142	81.6
¹³C chemical shifts	145	28	19.3

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	76	97.4
¹³C chemical shifts	50	50	100.0
¹⁵N chemical shifts	16	13	81.2

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	22	100.0

Entity_assemble_ID: B

Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
60	A	H61	7.973
60	A	H62	6.581
61	G	H21	7.989
61	G	H22	5.869
63	G	H21	7.5
63	G	H22	5.611

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	62	58	93.5
¹³C chemical shifts	47	0	0.0
¹⁵N chemical shifts	4	0	0.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	42	38	90.5
¹³C chemical shifts	35	0	0.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	20	20	100.0
¹³C chemical shifts	12	0	0.0
¹⁵N chemical shifts	4	0	0.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	4	4	100.0
¹³C chemical shifts	4	0	0.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 100.0%
- Total number of restraints: 747
- Weight of restraints: 1.0 (747)
- Potential type of restraints: square-well-parabolic (747)
- Range of distance target values: 2.4, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 86.2%
    - Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 100.0%
  - Total number of restraints: 82
  - Weight of restraints: 1.0 (82)
  - Potential type of restraints: square-well-parabolic (82)
  - Range of distance target values: 1.95, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
  - Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 100.0%
- Total number of restraints: 150
- Total number of restraints per polymer type: 150
- Weight of restraints: 1.0 (150)
- Potential type of restraints: square-well-parabolic (150)
- Dihedral angle restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Saveframe: CNS/XPLOR_dihedral_5
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 89.7%
    - Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 85.7%
  - Total number of restraints: 96
  - Total number of restraints per polymer type: 96
  - Weight of restraints: 1.0 (96)
  - Potential type of restraints: square-well-parabolic (96)
  - Dihedral angle restraints per residue
    - Chain_ID: A
    - Chain_ID: B
  - Saveframe: CNS/XPLOR_dihedral_6
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
      - Entity_assembly_ID: B, Chain length: 7, Sequence coverage: 100.0%
    - Total number of restraints: 36
    - Total number of restraints per polymer type: 36
    - Weight of restraints: 1.0 (36)
    - Potential type of restraints: square-well-parabolic (36)
    - Dihedral angle restraints per residue
      - Chain_ID: A
      - Chain_ID: B

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_7
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 62.1%
- Total number of restraints: 20
- Potential type of restraints: undefined (20)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords 5'-splice site, EBS1, group II intron, hairpin, IBS1, ribozyme, RNA, splicing

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.352 seconds)

BMRB: 18893

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Related entities 1. RNA (29-MER), : 1 : 2 entities Detail

Experiments performed 18 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail