BMRBj - BMREntryMaster

Found 1 Document (0.369 seconds)

BMRB: 18894

2M24

NMR solution structure of the d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma

Authors

Kruschel, D., Skilandat, M., Sigel, R.K. O.

Assembly

d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma

Entity

1. d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma (polymer, Thiol state: not present), 29 monomers, 9364.517 Da Detail

GGAGUAUGUA UUGGCACUGA GCAUACUCC

Formula weight

9364.517 Da

Source organism

Saccharomyces cerevisiae

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 68.5 %, Completeness (bb): 59.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	68.5 % (317 of 463)	81.3 % (205 of 252)	52.3 % (102 of 195)	62.5 % (10 of 16)
Suger, PO4	59.2 % (189 of 319)	77.6 % (135 of 174)	37.2 % (54 of 145)
Nucleobase	88.9 % (128 of 144)	89.7 % (70 of 78)	96.0 % (48 of 50)	62.5 % (10 of 16)
Aromatic	90.9 % (120 of 132)	93.9 % (62 of 66)	96.0 % (48 of 50)	62.5 % (10 of 16)

1. RNA (29-MER)

GGAGUAUGUA UUGGCACUGA GCAUACUCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
5	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
6	potassium chloride	natural abundance	10 mM
7	EDTA	natural abundance	10 uM
8	D2O	natural abundance	10 %
9	H2O	natural abundance	90 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
10	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	natural abundance	10 %
14	H2O	natural abundance	90 %

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
15	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
16	potassium chloride	natural abundance	10 mM
17	EDTA	natural abundance	10 uM
18	Pf1 phage	natural abundance	25.6 mg/mL
19	D2O	natural abundance	10 %
20	H2O	natural abundance	90 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
21	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
22	potassium chloride	natural abundance	10 mM
23	EDTA	natural abundance	10 uM
24	D2O	natural abundance	100 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
25	RNA (29-MER)	[3',4',5',5'',5, 100% 2H]	0.6 mM
26	potassium chloride	natural abundance	10 mM
27	EDTA	natural abundance	10 uM
28	D2O	natural abundance	100 %

Release date

2013-12-15

Citation

NMR structure of the 5' splice site in the group IIB intron Sc.ai5γ--conformational requirements for exon-intron recognition
Kruschel, D., Skilandat, M., Sigel, R.K.O.
RNA (2014), 20, 295-307, PubMed 24448450 , DOI 10.1261/rna.041137.113 , Abstract

Related entities 1. d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma, : 1 : 2 entities Detail

Experiments performed 15 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI inverse triple-resonance probehead with z-axis gradient

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
6	potassium chloride	natural abundance	10 mM
7	EDTA	natural abundance	10 uM
8	D2O	natural abundance	10 %
9	H2O	natural abundance	90 %

5 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI inverse triple-resonance probehead with z-axis gradient

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
6	potassium chloride	natural abundance	10 mM
7	EDTA	natural abundance	10 uM
8	D2O	natural abundance	10 %
9	H2O	natural abundance	90 %

6 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
10	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	natural abundance	10 %
14	H2O	natural abundance	90 %

7 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
10	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	natural abundance	10 %
14	H2O	natural abundance	90 %

8 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
10	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	natural abundance	10 %
14	H2O	natural abundance	90 %

9 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
15	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
16	potassium chloride	natural abundance	10 mM
17	EDTA	natural abundance	10 uM
18	Pf1 phage	natural abundance	25.6 mg/mL
19	D2O	natural abundance	10 %
20	H2O	natural abundance	90 %

10 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State anisotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
15	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
16	potassium chloride	natural abundance	10 mM
17	EDTA	natural abundance	10 uM
18	Pf1 phage	natural abundance	25.6 mg/mL
19	D2O	natural abundance	10 %
20	H2O	natural abundance	90 %

11 2D JNN HNN COSY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
10	RNA (29-MER)	[U-100% 13C; U-100% 15N]	0.7 mM
11	potassium chloride	natural abundance	10 mM
12	EDTA	natural abundance	10 uM
13	D2O	natural abundance	10 %
14	H2O	natural abundance	90 %

12 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

13 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

14 1D 31P

Instrument

Bruker Avance - 500 MHz CRYO QNP probehead, z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
1	RNA (29-MER)	natural abundance	0.4 ~ 1.2 mM
2	potassium chloride	natural abundance	10 mM
3	EDTA	natural abundance	10 uM
4	D2O	natural abundance	100 %

15 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI z-axis pulsed field gradient, inverse triple-resonance probehead

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K

#	Name	Isotope labeling	Concentration
25	RNA (29-MER)	[3',4',5',5'',5, 100% 2H]	0.6 mM
26	potassium chloride	natural abundance	10 mM
27	EDTA	natural abundance	10 uM
28	D2O	natural abundance	100 %

NMR combined restraints 8 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_18894_2m24.nef
Input source #2: Coordindates	2m24.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---------
GGAGUAUGUAUUGGCACUGAGCAUACUCC
|||||||||||||||||||||||||||||
GGAGUAUGUAUUGGCACUGAGCAUACUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	29	0	0	100.0

Content subtype: combined_18894_2m24.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	343		100.0 (chain: A, length: 29)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	510 (1)	noe	100.0 (chain: A, length: 29)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	45 (1)	hbond	62.1 (chain: A, length: 29)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_4	OK	103 (103)	.	100.0 (chain: A, length: 29)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	48 (48)	.	55.2 (chain: A, length: 29)
3	Dihedral angle restraints	CNS/XPLOR_dihedral_6	OK	29 (29)	.	100.0 (chain: A, length: 29)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_7	Warning	7 (7)	.	20.7 (chain: A, length: 29)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%

--------10--------20---------
GGAGUAUGUAUUGGCACUGAGCAUACUCC
|||||||||||||||||||||||||||||
GGAGUAUGUAUUGGCACUGAGCAUACUCC

Total number of assignments
- ¹H chemical shifts: 223
- ¹³C chemical shifts: 102
- ¹⁵N chemical shifts: 18

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H21	7.326
1	G	H22	5.318
2	G	H21	7.52
2	G	H22	5.343
3	A	H61	7.704
3	A	H62	6.383
3	A	N1	219.963
4	G	H21	7.744
4	G	H22	5.617
6	A	H61	7.249
6	A	H62	5.852
6	A	N1	222.05
8	G	H21	7.244
8	G	H22	5.347
21	G	H21	7.255
21	G	H22	5.704
22	C	N3	195.59
23	A	H61	7.236
23	A	H62	5.827
23	A	N1	219.752
25	A	H61	7.277
25	A	H62	5.823
25	A	N1	221.457
26	C	N3	196.118
28	C	N3	197.061
29	C	N3	196.583

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	252	205	81.3
¹³C chemical shifts	195	102	52.3
¹⁵N chemical shifts	16	10	62.5

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	135	77.6
¹³C chemical shifts	145	54	37.2

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	70	89.7
¹³C chemical shifts	50	48	96.0
¹⁵N chemical shifts	16	10	62.5

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	20	90.9

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
- Total number of restraints: 510
- Weight of restraints: 1.0 (510)
- Potential type of restraints: square-well-parabolic (510)
- Range of distance target values: 2.4, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 62.1%
  - Total number of restraints: 45
  - Weight of restraints: 1.0 (45)
  - Potential type of restraints: square-well-parabolic (45)
  - Range of distance target values: 1.95, 2.95 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
- Total number of restraints: 103
- Total number of restraints per polymer type: 103
- Weight of restraints: 1.0 (103)
- Potential type of restraints: square-well-parabolic (103)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_5
  - Status: OK
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 55.2%
  - Total number of restraints: 48
  - Total number of restraints per polymer type: 48
  - Weight of restraints: 1.0 (48)
  - Potential type of restraints: square-well-parabolic (48)
  - Dihedral angle restraints per residue
    - Chain_ID: A
  - Saveframe: CNS/XPLOR_dihedral_6
    - Status: OK
    - Experiment type: .
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 100.0%
    - Total number of restraints: 29
    - Total number of restraints per polymer type: 29
    - Weight of restraints: 1.0 (29)
    - Potential type of restraints: square-well-parabolic (29)
    - Dihedral angle restraints per residue
      - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_7
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 29, Sequence coverage: 20.7%
- Total number of restraints: 7
- Potential type of restraints: undefined (7)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue

Keywords EBS1, group II intron, hairpin, ribozyme, RNA, splicing

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.369 seconds)

BMRB: 18894

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Related entities 1. d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma, : 1 : 2 entities Detail

Experiments performed 15 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 8 contents Detail