Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
CGGGGCGGGCCTTGGGCGGGGT
||||||||||||||||||||||
CGGGGCGGGCCTTGGGCGGGGT

Chain assignments

Content subtype: combined_18902_2m27.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list_1
   • Status: OK
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     CGGGGCGGGCCTTGGGCGGGGT
     ||||||||||||||||||||||
     CGGGGCGGGCCTTGGGCGGGGT
     

   • Total number of assignments
     • ¹H chemical shifts: 196
   • Completeness of assignments
     • Entity_assemble_ID: A
       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	211	196	92.9

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	154	154	100.0

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	57	42	73.7

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	3	3	100.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	14	14	100.0

   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: CNS/XPLOR_distance_constraints_2
   • Status: OK
   • Experiment type: noe
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%

     --------10--------20--
     CGGGGCGGGCCTTGGGCGGGGT
     ||||||||||||||||||||||
     CGGGGCGGGCCTTGGGCGGGGT
     

   • Total number of restraints: 407
     • Intra-residue restraints, i = j : 262
     • Sequential restraints, | i - j | = 1 : 115
       • Backbone-backbone: 19
       • Backbone-side chain: 78
       • Side chain-side chain: 18
     • Medium range restraints, 1 < | i - j | < 5 : 12
       • Side chain-side chain: 12
     • Long range restraints, | i - j | >= 5 : 18
   • Weight of restraints: 1.0 (407)
     • Intra-residue restraints, i = j : 1.0 (262)
     • Sequential restraints, | i - j | = 1 : 1.0 (115)
       • Backbone-backbone: 1.0 (19)
       • Backbone-side chain: 1.0 (78)
       • Side chain-side chain: 1.0 (18)
     • Medium range restraints, 1 < | i - j | < 5 : 1.0 (12)
       • Side chain-side chain: 1.0 (12)
     • Long range restraints, | i - j | >= 5 : 1.0 (18)
   • Potential type of restraints: square-well-parabolic (407)
     • Intra-residue restraints, i = j : square-well-parabolic (262)
     • Sequential restraints, | i - j | = 1 : square-well-parabolic (115)
       • Backbone-backbone: square-well-parabolic (19)
       • Backbone-side chain: square-well-parabolic (78)
       • Side chain-side chain: square-well-parabolic (18)
     • Medium range restraints, 1 < | i - j | < 5 : square-well-parabolic (12)
       • Side chain-side chain: square-well-parabolic (12)
     • Long range restraints, | i - j | >= 5 : square-well-parabolic (18)
   • Range of distance target values: 1.64, 6.5 (Å)
   • Histogram of distance target values
   • Histogram of discrepancy in distance target values
   • Distance restraints per residue
     • Chain_ID: A
   • Distance restraints on contact map
     • Chain_ID_1: A - Chain_ID_2: A