BMRBj - BMREntryMaster

Found 1 Document (0.437 seconds)

BMRB: 19081

2M5U

NMR structure of the P4 hairpin of the CPEB3 ribozyme

Authors

Skilandat, M., Rowinska-Zyrek, M., Sigel, R.K.O.

Assembly

P4 CPEB3

Entity

1. P4 CPEB3 (polymer, Thiol state: not present), 22 monomers, 7114.181 Da Detail

GGCAGAUUCU GGUGAAUCUG CC

Formula weight

7114.181 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 85.4 %, Completeness (bb): 81.8 % Detail

Polymer type: polyribonucleotide

	Total	¹H
All	85.4 % (164 of 192)	85.4 % (164 of 192)
Suger, PO4	81.8 % (108 of 132)	81.8 % (108 of 132)
Nucleobase	93.3 % (56 of 60)	93.3 % (56 of 60)
Aromatic	92.0 % (46 of 50)	92.0 % (46 of 50)

1. P4 CPEB3

GGCAGAUUCU GGUGAAUCUG CC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	D2O	natural abundance	100 %
2	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
3	KCl	natural abundance	50 mM
4	EDTA	natural abundance	10 uM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	D2O	natural abundance	10 %
6	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
7	H2O	natural abundance	90 %
8	KCl	natural abundance	50 mM
9	EDTA	natural abundance	10 uM

Release date

2014-03-30

Citation

Solution structure and metal ion binding sites of the human CPEB3 ribozyme's P4 domain
Skilandat, M., Rowinska-Zyrek, M., Sigel, R.K.O.
J. Biol. Inorg. Chem. (2014), 19, 903-912, PubMed 24652468 , DOI 10.1007/s00775-014-1125-6 , Abstract

Related entities 1. P4 CPEB3, : 1 entities Detail

Experiments performed 6 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI inverse triple-resonance with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	D2O	natural abundance	10 %
6	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
7	H2O	natural abundance	90 %
8	KCl	natural abundance	50 mM
9	EDTA	natural abundance	10 uM

2 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI inverse triple-resonance with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	D2O	natural abundance	10 %
6	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
7	H2O	natural abundance	90 %
8	KCl	natural abundance	50 mM
9	EDTA	natural abundance	10 uM

3 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz CRYO TXI inverse triple-resonance with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	D2O	natural abundance	10 %
6	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
7	H2O	natural abundance	90 %
8	KCl	natural abundance	50 mM
9	EDTA	natural abundance	10 uM

4 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz CRYO TXI inverse triple-resonance with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	D2O	natural abundance	100 %
2	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
3	KCl	natural abundance	50 mM
4	EDTA	natural abundance	10 uM

5 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz CRYO TCI inverse triple-resonance with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 278 K, pH 6.8

#	Name	Isotope labeling	Concentration
1	D2O	natural abundance	100 %
2	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
3	KCl	natural abundance	50 mM
4	EDTA	natural abundance	10 uM

6 1D 31P

Instrument

Bruker Avance - 500 MHz CRYO 5 mm QNP with actively shielded z-gradient coil

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8

#	Name	Isotope labeling	Concentration
5	D2O	natural abundance	10 %
6	P4_CPEB3	natural abundance	0.7 ~ 0.8 mM
7	H2O	natural abundance	90 %
8	KCl	natural abundance	50 mM
9	EDTA	natural abundance	10 uM

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_19081_2m5u.nef
Input source #2: Coordindates	2m5u.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
GGCAGAUUCUGGUGAAUCUGCC
||||||||||||||||||||||
GGCAGAUUCUGGUGAAUCUGCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	22	0	0	100.0

Content subtype: combined_19081_2m5u.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	179		100.0 (chain: A, length: 22)
1	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	449 (1)	noe	100.0 (chain: A, length: 22)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	46 (1)	hbond	81.8 (chain: A, length: 22)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_2	OK	157 (157)	.	100.0 (chain: A, length: 22)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 179
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	G	H22	5.735
4	A	H61	7.803
4	A	H62	6.346
5	G	H21	8.037
5	G	H22	6.073
6	A	H61	8.003
6	A	H62	6.789
14	G	H21	7.898
14	G	H22	5.981
15	A	H61	8.001
15	A	H62	6.728
16	A	H61	8.169
16	A	H62	6.926
20	G	H21	8.155
20	G	H22	5.971

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	192	164	85.4

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	132	108	81.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	60	56	93.3

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	15	15	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_3
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 449
- Weight of restraints: 1.0 (449)
- Potential type of restraints: square-well-parabolic (449)
- Range of distance target values: 2.4, 5.5 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 81.8%
  - Total number of restraints: 46
  - Weight of restraints: 1.0 (46)
  - Potential type of restraints: square-well-parabolic (46)
  - Range of distance target values: 1.9, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 157
- Total number of restraints per polymer type: 157
- Weight of restraints: 1.0 (157)
- Potential type of restraints: square-well-parabolic (157)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords CPEB3, hairpin, ribozyme, RNA, UGGU tetraloop

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.437 seconds)

BMRB: 19081

Sample #1

Sample #2

Related entities 1. P4 CPEB3, : 1 entities Detail

Experiments performed 6 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail