Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions
Polymer type: polydeoxyribonucleotide
Total | 1H | 31P | |
---|---|---|---|
All | 87.0 % (214 of 246) | 86.5 % (192 of 222) | 91.7 % (22 of 24) |
Suger, PO4 | 94.8 % (182 of 192) | 95.2 % (160 of 168) | 91.7 % (22 of 24) |
Nucleobase | 59.3 % (32 of 54) | 59.3 % (32 of 54) | |
Aromatic | 54.2 % (26 of 48) | 54.2 % (26 of 48) | |
Methyl | 100.0 % (6 of 6) | 100.0 % (6 of 6) |
1. DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')
GGGGTTGGGG TTTTGGGGAA GGGGSolvent system 93% H2O/7% D2O, Pressure 1 atm, Temperature 293 K, pH 7.8
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') | natural abundance | 4.0 ~ 6.0 mM | |
2 | sodium phosphate | natural abundance | 20 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 293 K, pH 7.8
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
3 | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') | natural abundance | 4.0 ~ 6.0 mM | |
4 | sodium phosphate | natural abundance | 20 mM |
Polymer type: polydeoxyribonucleotide
Total | 1H | 31P | |
---|---|---|---|
All | 81.1 % (399 of 492) | 84.9 % (377 of 444) | 45.8 % (22 of 48) |
Suger, PO4 | 83.3 % (320 of 384) | 88.7 % (298 of 336) | 45.8 % (22 of 48) |
Nucleobase | 73.1 % (79 of 108) | 73.1 % (79 of 108) | |
Aromatic | 69.8 % (67 of 96) | 69.8 % (67 of 96) | |
Methyl | 100.0 % (12 of 12) | 100.0 % (12 of 12) |
1. DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3')
GGGGTTGGGG TTTTGGGGAA GGGGSolvent system 93% H2O/7% D2O, Pressure 1 atm, Temperature 278 K, pH 7.8
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') | natural abundance | 4.0 ~ 6.0 mM | |
2 | sodium phosphate | natural abundance | 20 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 278 K, pH 7.8
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
3 | DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') | natural abundance | 4.0 ~ 6.0 mM | |
4 | sodium phosphate | natural abundance | 20 mM |