BMRBj - BMREntryMaster

Found 1 Document (0.361 seconds)

BMRB: 25526

2N0J

Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex

Authors

Duchardt-Ferner, E., Gottstein-Schmidtke, S.R., Weigand, J.E., Ohlenschlaeger, O.E., Wurm, J., Hammann, C., Suess, B., Woehnert, J.

Assembly

RNA 27-MER, RIBOSTAMYCIN

Entity

1. RNA (27-MER) (polymer, Thiol state: not present), 27 monomers, 8620.002 Da Detail

GGCUGCUUGU CCUUUAAUGG UCCAGUC

2. RIBOSTAMYCIN (non-polymer), 454.473 Da

Total weight

9074.475 Da

Max. entity weight

8620.002 Da

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 84.3 %, Completeness (bb): 92.3 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	84.3 % (393 of 466)	85.4 % (205 of 240)	98.9 % (180 of 182)	0.0 % (0 of 17)	29.6 % (8 of 27)
Suger, PO4	92.3 % (299 of 324)	97.5 % (158 of 162)	98.5 % (133 of 135)		29.6 % (8 of 27)
Nucleobase	66.2 % (94 of 142)	60.3 % (47 of 78)	100.0 % (47 of 47)	0.0 % (0 of 17)
Aromatic	73.4 % (94 of 128)	73.4 % (47 of 64)	100.0 % (47 of 47)	0.0 % (0 of 17)

1. RNA (27-MER)

GGCUGCUUGU CCUUUAAUGG UCCAGUC

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
1	entity_1	natural abundance	0.8 mM
2	potassium phosphate	natural abundance	25 mM
3	potassium chloride	natural abundance	50 mM
4	H2O	natural abundance	90 %
5	D2O	natural abundance	10 %

Sample #2

Solvent system 90% H2O/10% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
6	entity_1	[U-100% 15N]	0.8 mM
7	RIBOSTAMYCIN	natural abundance	0.9 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	H2O	natural abundance	90 %
11	D2O	natural abundance	10 %

Sample #3

Solvent system 100% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
12	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
13	RIBOSTAMYCIN	natural abundance	1.2 mM
14	potassium phosphate	natural abundance	25 mM
15	potassium chloride	natural abundance	50 mM
16	D2O	natural abundance	100 %

Sample #4

Solvent system 100% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
17	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
18	RIBOSTAMYCIN	natural abundance	1.2 mM
19	potassium phosphate	natural abundance	25 mM
20	potassium chloride	natural abundance	50 mM
21	D2O	natural abundance	100 %

Sample #5

Solvent system 90% H2O/10% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
22	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
23	RIBOSTAMYCIN	natural abundance	1.2 mM
24	potassium phosphate	natural abundance	25 mM
25	potassium chloride	natural abundance	50 mM
26	H2O	natural abundance	90 %
27	D2O	natural abundance	10 %

Sample #6

Solvent system 90% H2O/10% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
28	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
29	RIBOSTAMYCIN	natural abundance	1.2 mM
30	potassium phosphate	natural abundance	25 mM
31	potassium chloride	natural abundance	50 mM
32	H2O	natural abundance	90 %
33	D2O	natural abundance	10 %

Release date

2016-01-31

Citation 1

What a Difference an OH Makes: Conformational Dynamics as the Basis for the Ligand Specificity of the Neomycin-Sensing Riboswitch
Elke, D., Julia, W.E., Oliver, O., Sina, S.R., Beatrix, S., Jens, W.
Angew. Chem Int Ed Engl. (2015), 55, 1527-1530, PubMed 26661511 , DOI 10.1002/anie.201507365 , Abstract

Show more 1 citaion

Citation 2

NMR resonance assignments of an engineered neomycin-sensing riboswitch RNA bound to ribostamycin and tobramycin
Sina, S.R., Elke, D., Julia, W.E., Beatrix, S., Jens, W.
Biomol. NMR Assign. (2010), 4, 115-118, PubMed 20306311 , DOI 10.1007/s12104-010-9223-z , Abstract

Hide non-primary 1 citaion

Related entities 1. RNA (27-MER), : 1 : 2 entities Detail

Experiments performed 13 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 282.5 (±15.5) K, pH 6.2

#	Name	Isotope labeling	Concentration
1	entity_1	natural abundance	0.8 mM
2	potassium phosphate	natural abundance	25 mM
3	potassium chloride	natural abundance	50 mM
4	H2O	natural abundance	90 %
5	D2O	natural abundance	10 %

2 2D 1H-15N HSQC

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	entity_1	[U-100% 15N]	0.8 mM
7	RIBOSTAMYCIN	natural abundance	0.9 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	H2O	natural abundance	90 %
11	D2O	natural abundance	10 %

3 3D 1H-15N NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	entity_1	[U-100% 15N]	0.8 mM
7	RIBOSTAMYCIN	natural abundance	0.9 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	H2O	natural abundance	90 %
11	D2O	natural abundance	10 %

4 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
12	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
13	RIBOSTAMYCIN	natural abundance	1.2 mM
14	potassium phosphate	natural abundance	25 mM
15	potassium chloride	natural abundance	50 mM
16	D2O	natural abundance	100 %

5 3D HNCO

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
22	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
23	RIBOSTAMYCIN	natural abundance	1.2 mM
24	potassium phosphate	natural abundance	25 mM
25	potassium chloride	natural abundance	50 mM
26	H2O	natural abundance	90 %
27	D2O	natural abundance	10 %

6 3D H(CCO)NH

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
22	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
23	RIBOSTAMYCIN	natural abundance	1.2 mM
24	potassium phosphate	natural abundance	25 mM
25	potassium chloride	natural abundance	50 mM
26	H2O	natural abundance	90 %
27	D2O	natural abundance	10 %

7 3D 1H-13C NOESY

Instrument

Bruker Avance - 900 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
12	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
13	RIBOSTAMYCIN	natural abundance	1.2 mM
14	potassium phosphate	natural abundance	25 mM
15	potassium chloride	natural abundance	50 mM
16	D2O	natural abundance	100 %

8 3D 1H-13C NOESY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
12	entity_1	[U-100% 13C; U-100% 15N]	1.1 mM
13	RIBOSTAMYCIN	natural abundance	1.2 mM
14	potassium phosphate	natural abundance	25 mM
15	potassium chloride	natural abundance	50 mM
16	D2O	natural abundance	100 %

9 2D 1H-1H TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
17	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
18	RIBOSTAMYCIN	natural abundance	1.2 mM
19	potassium phosphate	natural abundance	25 mM
20	potassium chloride	natural abundance	50 mM
21	D2O	natural abundance	100 %

10 2D DQF-COSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
17	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
18	RIBOSTAMYCIN	natural abundance	1.2 mM
19	potassium phosphate	natural abundance	25 mM
20	potassium chloride	natural abundance	50 mM
21	D2O	natural abundance	100 %

11 2D 1H-1H NOESY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
17	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
18	RIBOSTAMYCIN	natural abundance	1.2 mM
19	potassium phosphate	natural abundance	25 mM
20	potassium chloride	natural abundance	50 mM
21	D2O	natural abundance	100 %

12 2D 1H-1H TOCSY

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
28	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
29	RIBOSTAMYCIN	natural abundance	1.2 mM
30	potassium phosphate	natural abundance	25 mM
31	potassium chloride	natural abundance	50 mM
32	H2O	natural abundance	90 %
33	D2O	natural abundance	10 %

13 2D 1H-1H NOESY

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
28	entity_1	[U-13C; U-15N; U-2H]	1.1 mM
29	RIBOSTAMYCIN	natural abundance	1.2 mM
30	potassium phosphate	natural abundance	25 mM
31	potassium chloride	natural abundance	50 mM
32	H2O	natural abundance	90 %
33	D2O	natural abundance	10 %

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_25526_2n0j.nef
Input source #2: Coordindates	2n0j.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	RIO	RIBOSTAMYCIN	None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-------
GGCUGCUUGUCCUUUAAUGGUCCAGUC
|||||||||||||||||||||||||||
GGCUGCUUGUCCUUUAAUGGUCCAGUC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	27	0	0	100.0

Content subtype: combined_25526_2n0j.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	420		100.0 (chain: A, length: 27)
1	Distance restraints	DYANA/DIANA_distance_constraints_4	Warning	788 (1)	noe	96.3 (chain: A, length: 27)
2	Distance restraints	DYANA/DIANA_distance_constraints_3	OK	56 (1)	hbond	85.2 (chain: A, length: 27)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 100.0%

--------10--------20-------
GGCUGCUUGUCCUUUAAUGGUCCAGUC
|||||||||||||||||||||||||||
GGCUGCUUGUCCUUUAAUGGUCCAGUC

Total number of assignments
- ¹H chemical shifts: 205
- ¹³C chemical shifts: 180
- ¹⁵N chemical shifts: 27
- ³¹P chemical shifts: 8

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	N9	175.0
2	G	N9	175.5
3	C	N1	168.0
4	U	N1	165.7
5	G	N9	174.5
6	C	N1	167.0
7	U	N1	164.8
7	U	P	-0.36
8	U	N1	165.8
8	U	P	-0.49
9	G	N9	174.5
9	G	P	-3.22
10	U	N1	166.9
11	C	N1	166.5
12	C	N1	168.2
13	U	N1	165.7
14	U	N1	166.5
15	U	N1	165.9
15	U	P	1.58
16	A	N9	174.6
16	A	P	0.29
17	A	N9	176.8
17	A	P	-2.78
18	U	N1	165.7
18	U	P	1.3
19	G	N9	176.4
19	G	P	-0.02
20	G	N9	174.7
21	U	N1	167.2
22	C	N1	168.2
23	C	N1	167.4
24	A	N9	176.0
25	G	N9	175.2
26	U	N1	165.5
27	C	N1	167.7

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	240	205	85.4
¹³C chemical shifts	182	180	98.9
¹⁵N chemical shifts	17	0	0.0

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	162	158	97.5
¹³C chemical shifts	135	133	98.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	78	47	60.3
¹³C chemical shifts	47	47	100.0
¹⁵N chemical shifts	17	0	0.0

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	13	13	100.0
¹³C chemical shifts	13	13	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_4
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 96.3%
- Total number of restraints: 788
- Weight of restraints: 1.0 (788)
- Potential type of restraints: upper-bound-parabolic (788)
- Range of distance target values: 2.8, 6.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map
- Saveframe: DYANA/DIANA_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 27, Sequence coverage: 85.2%
  - Total number of restraints: 56
  - Weight of restraints: 1.0 (56)
  - Potential type of restraints: upper-bound-parabolic (56)
  - Range of distance target values: 2.0, 3.2 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
    - Chain_ID: B
      None
  - Distance restraints on contact map

Keywords Aminoglycosides, RNA recognition, RNA structure, RNA-ligand interaction, Riboswitches

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.361 seconds)

BMRB: 25526

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Related entities 1. RNA (27-MER), : 1 : 2 entities Detail

Experiments performed 13 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 4 contents Detail