BMRBj - BMREntryMaster

	Total	¹³C	¹⁵N	³¹P
All	65.3 % (139 of 213)	69.0 % (120 of 174)	76.9 % (10 of 13)	34.6 % (9 of 26)
Suger, PO4	62.8 % (98 of 156)	68.5 % (89 of 130)		34.6 % (9 of 26)
Nucleobase	71.9 % (41 of 57)	70.5 % (31 of 44)	76.9 % (10 of 13)
Aromatic	71.9 % (41 of 57)	70.5 % (31 of 44)	76.9 % (10 of 13)

1. 26mer Box C/D RNA

GCUGAGCUCG AAAGAGCAAU GAUGUC

Show sample condition

Sample

Solvent system H2O, Temperature 260 K, pH 7.5

#	Name	Isotope labeling	Type	Concentration
1	entity	nucleotide-type-selective [U-99% 13C; U-99% 15N]		20 mg/mL
2	H2O	natural abundance		100 %

Release date

2015-05-07

Citation

RNA structure determination by solid-state NMR spectroscopy
Marchanka, A., Simon, B., Althoff-Ospelt, G., Carlomagno, T.
Nat. Commun. (2015), 6, 7024-7024, PubMed 25960310 , DOI 10.1038/ncomms8024 , Abstract

Related entities 1. 26mer Box C/D RNA (5'-R(PCPUPGPAPGPCPUPCPGPAPAPAPGPAPGPCPAPAPUPGPAPUP*G)-3'), : 1 : 1 entities Detail

Experiments performed 5 experiments Detail

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_25534_2n0r.nef
Input source #2: Coordindates	2n0r.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20------
GCUGAGCUCGAAAGAGCAAUGAUGUC
||||||||||||||||||||||||||
GCUGAGCUCGAAAGAGCAAUGAUGUC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	26	0	0	100.0

Content subtype: combined_25534_2n0r.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	231		76.9 (chain: A, length: 26)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	221 (1)	noe	73.1 (chain: A, length: 26)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	34 (1)	hbond	61.5 (chain: A, length: 26)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	Warning	174 (173)	.	92.3 (chain: A, length: 26)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 76.9%

--------10--------20------
GCUGAGCUCGAAAGAGCAAUGAUGUC
 |||||||||   |||||||||||  
.CUGAGCUCG...GAGCAAUGAUG  
--------10--------20----

Total number of assignments
- ¹³C chemical shifts: 173
- ¹⁵N chemical shifts: 49
- ³¹P chemical shifts: 9

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	C	C2	158.1
3	U	C2	154.1
3	U	C4	165.7
3	U	N1	145.5
4	G	C2	156.6
4	G	C4	155.3
4	G	C5	116.7
4	G	C6	160.3
4	G	N2	81.4
4	G	N9	167.0
4	G	P	-3.8
5	A	C4	150.9
5	A	C5	118.8
5	A	C6	156.6
5	A	N6	81.4
5	A	N9	166.9
5	A	P	-0.7
6	G	C2	158.2
6	G	C4	152.2
6	G	C5	119.5
6	G	C6	157.9
6	G	N2	75.8
6	G	N9	171.1
6	G	P	-3.8
7	C	C2	159.3
7	C	C4	168.1
7	C	N1	152.2
7	C	N3	196.3
7	C	N4	100.1
8	U	C2	152.8
8	U	C4	169.4
8	U	N1	145.5
9	C	C2	158.2
9	C	C4	168.1
9	C	N1	151.7
9	C	N3	197.7
9	C	N4	99.1
10	G	C4	155.5
10	G	C6	161.7
10	G	N2	75.5
10	G	N9	171.3
14	G	C2	157.5
14	G	C4	151.9
14	G	C5	119.2
14	G	N2	75.4
14	G	N9	170.1
15	A	C4	148.6
15	A	C5	120.6
15	A	C6	157.6
15	A	N1	222.1
15	A	N9	171.5
16	G	C2	157.0
16	G	C4	151.6
16	G	C5	119.0
16	G	C6	160.9
16	G	N2	74.6
16	G	N9	170.9
17	C	C2	158.5
17	C	C4	167.6
17	C	N1	150.5
17	C	N3	195.9
17	C	N4	99.0
18	A	C4	150.6
18	A	C5	121.6
18	A	C6	157.7
18	A	N6	80.7
18	A	N7	230.9
18	A	N9	173.2
18	A	P	-4.2
19	A	C4	150.5
19	A	C5	121.8
19	A	C6	156.4
19	A	N6	76.3
19	A	N7	228.2
19	A	N9	164.7
19	A	P	-1.8
20	U	C2	154.2
20	U	C4	167.9
20	U	N1	147.4
20	U	P	-5.3
21	G	C4	155.7
21	G	C5	117.6
21	G	C6	160.3
21	G	N2	81.0
21	G	N9	168.8
21	G	P	-6.0
22	A	C4	147.5
22	A	C5	120.8
22	A	C6	157.1
22	A	N6	81.2
22	A	N9	170.2
22	A	P	-0.1
23	U	C2	151.0
23	U	C4	167.6
23	U	N1	144.7
23	U	P	-4.2
24	G	C2	157.4
24	G	C4	152.9
24	G	C5	118.1
24	G	N2	76.5
24	G	N9	172.4

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹³C chemical shifts	174	120	69.0
¹⁵N chemical shifts	13	10	76.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹³C chemical shifts	130	89	68.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹³C chemical shifts	44	31	70.5
¹⁵N chemical shifts	13	10	76.9

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹³C chemical shifts	24	17	70.8

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 73.1%
- Total number of restraints: 221
- Weight of restraints: 1.0 (221)
- Potential type of restraints: square-well-parabolic (221)
- Range of distance target values: 3.0, 6.25 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 61.5%
  - Total number of restraints: 34
  - Weight of restraints: 1.0 (34)
  - Potential type of restraints: square-well-parabolic (34)
  - Range of distance target values: 1.8, 3.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: Warning
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 26, Sequence coverage: 92.3%
- Total number of restraints: 173
- Total number of restraints per polymer type: 173
- Weight of restraints: 1.0 (173)
- Potential type of restraints: square-well-parabolic (173)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords RNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.54 seconds)

BMRB: 25534

Sample

Related entities 1. 26mer Box C/D RNA (5'-R(PCPUPGPAPGPCPUPCPGPAPAPAPGPAPGPCPAPAPUPGPAPUP*G)-3'), : 1 : 1 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.54 seconds)

BMRB: 25534

Sample

Related entities 1. 26mer Box C/D RNA (5'-R(P*CP*UP*GP*AP*GP*CP*UP*CP*GP*AP*AP*AP*GP*AP*GP*CP*AP*AP*UP*GP*AP*UP*G)-3'), : 1 : 1 entities Detail

Experiments performed 5 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail

Related entities 1. 26mer Box C/D RNA (5'-R(PCPUPGPAPGPCPUPCPGPAPAPAPGPAPGPCPAPAPUPGPAPUP*G)-3'), : 1 : 1 entities Detail