Structure of murine tumour necrosis factor alpha CDE RNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | 31P | |
---|---|---|---|---|---|
All | 91.6 % (359 of 392) | 92.5 % (184 of 199) | 95.5 % (148 of 155) | 40.0 % (6 of 15) | 91.3 % (21 of 23) |
Suger, PO4 | 95.3 % (263 of 276) | 97.1 % (134 of 138) | 93.9 % (108 of 115) | 91.3 % (21 of 23) | |
Nucleobase | 82.8 % (96 of 116) | 82.0 % (50 of 61) | 100.0 % (40 of 40) | 40.0 % (6 of 15) | |
Aromatic | 83.6 % (92 of 110) | 83.6 % (46 of 55) | 100.0 % (40 of 40) | 40.0 % (6 of 15) |
1. RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3')
GCAUGUUUUC UGUGAAAACG GUUSolvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details water sample for immino analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
5 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details RDC sample
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
7 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
8 | Pf1 phage | natural abundance | 30 (±5.0) mg/mL |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details water sample for immino analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
5 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 600 MHz cyoprobe platform
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details main sample for chemical shift analysis
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
3 | D2O | [U-100% 2H] | 55 M |
Bruker Avance - 600 MHz cyoprobe platform
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details RDC sample
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
7 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
8 | Pf1 phage | natural abundance | 30 (±5.0) mg/mL |
Bruker Avance - 600 MHz cyoprobe platform
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1), Details RDC sample
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
6 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*UP*CP*UP*GP*UP*GP*AP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.30 (±0.05) mM | |
7 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
8 | Pf1 phage | natural abundance | 30 (±5.0) mg/mL |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_25603_2n2o.nef |
Input source #2: Coordindates | 2n2o.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--- GCAUGUUUUCUGUGAAAACGGUU ||||||||||||||||||||||| GCAUGUUUUCUGUGAAAACGGUU
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 23 | 0 | 0 | 100.0 |
Content subtype: combined_25603_2n2o.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
1 | G | N9 | 168.53 |
1 | G | P | -3.748 |
2 | C | N1 | 151.245 |
3 | A | N9 | 168.946 |
3 | A | P | -3.622 |
4 | U | N1 | 144.43 |
4 | U | P | -3.88 |
5 | G | N9 | 168.195 |
5 | G | P | -3.538 |
6 | U | N1 | 146.651 |
7 | U | N1 | 146.409 |
7 | U | P | -4.252 |
8 | U | P | -4.119 |
9 | U | N1 | 146.899 |
9 | U | P | -4.083 |
10 | C | N1 | 150.197 |
10 | C | N3 | 195.532 |
10 | C | P | -3.92 |
11 | U | N1 | 144.018 |
11 | U | P | -3.883 |
12 | G | N9 | 168.003 |
12 | G | P | -3.841 |
13 | U | N1 | 143.576 |
13 | U | P | -3.071 |
14 | G | N9 | 166.724 |
14 | G | P | -3.462 |
15 | A | N1 | 220.526 |
15 | A | N9 | 169.918 |
15 | A | P | -2.905 |
16 | A | N1 | 220.341 |
16 | A | P | -3.747 |
17 | A | H61 | 6.581 |
17 | A | N1 | 220.357 |
17 | A | N9 | 170.131 |
17 | A | P | -3.547 |
18 | A | N1 | 221.549 |
18 | A | N9 | 170.604 |
18 | A | P | -3.819 |
19 | C | N1 | 149.863 |
19 | C | N3 | 195.71 |
19 | C | P | -4.078 |
20 | G | N9 | 169.466 |
20 | G | P | -3.74 |
21 | G | N9 | 167.809 |
21 | G | P | -3.954 |
22 | U | N1 | 144.128 |
22 | U | P | -3.861 |
23 | U | N1 | 145.696 |
23 | U | P | -4.079 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 199 | 184 | 92.5 |
13C chemical shifts | 155 | 148 | 95.5 |
15N chemical shifts | 15 | 6 | 40.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 138 | 134 | 97.1 |
13C chemical shifts | 115 | 108 | 93.9 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 61 | 50 | 82.0 |
13C chemical shifts | 40 | 40 | 100.0 |
15N chemical shifts | 15 | 6 | 40.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 16 | 16 | 100.0 |
13C chemical shifts | 16 | 16 | 100.0 |
Distance restraints
Dihedral angle restraints
--------10--------20--- GCAUGUUUUCUGUGAAAACGGUU ||||||||||| |||||||| .CAUGUUUUCUG..AAAACGGU --------10--------20--
RDC restraints
--------10--------20--- GCAUGUUUUCUGUGAAAACGGUU |||| |||||||||||||||||| GCAU.UUUUCUGUGAAAACGGUU