Solution structure of a double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA
Polymer type: polyribonucleotide
Total | 1H | 13C | 31P | |
---|---|---|---|---|
All | 93.6 % (353 of 377) | 90.5 % (180 of 199) | 97.4 % (151 of 155) | 95.7 % (22 of 23) |
Suger, PO4 | 96.7 % (267 of 276) | 97.1 % (134 of 138) | 96.5 % (111 of 115) | 95.7 % (22 of 23) |
Nucleobase | 85.1 % (86 of 101) | 75.4 % (46 of 61) | 100.0 % (40 of 40) | |
Aromatic | 90.5 % (86 of 95) | 83.6 % (46 of 55) | 100.0 % (40 of 40) |
1. RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3')
GCAUGUUUAG UGUCUAAACG GUUSolvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
3 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
4 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
6 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
7 | Pf1 phage | natural abundance | 30 mg/mL |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
3 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
4 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
3 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
4 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 700 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
2 | sodium phosphate | natural abundance | 20 (±5.0) mM |
Bruker Avance - 800 MHz
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
6 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
7 | Pf1 phage | natural abundance | 30 mg/mL |
Bruker Avance - 800 MHz
State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 300 (±0.05) K, pH 6.5 (±0.1)
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
5 | RNA (5'-R(P*GP*CP*AP*UP*GP*UP*UP*UP*AP*GP*UP*GP*UP*CP*UP*AP*AP*AP*CP*GP*GP*UP*U)-3') | [U-100% 13C; U-100% 15N] | 0.35 (±0.05) mM | |
6 | sodium phosphate | natural abundance | 20 (±5.0) mM | |
7 | Pf1 phage | natural abundance | 30 mg/mL |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints | combined_25604_2n2p.nef |
Input source #2: Coordindates | 2n2p.cif |
Diamagnetism of the molecular assembly | True (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | None |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Warning |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
NoneNon-standard residues
NoneSequence alignments
--------10--------20--- GCAUGUUUAGUGUCUAAACGGUU ||||||||||||||||||||||| GCAUGUUUAGUGUCUAAACGGUU
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 23 | 0 | 0 | 100.0 |
Content subtype: combined_25604_2n2p.nef
Assigned chemical shifts
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
2 | C | P | -3.833 |
3 | A | P | -3.858 |
4 | U | P | -3.924 |
5 | G | P | -3.569 |
6 | U | P | -3.665 |
7 | U | P | -3.899 |
8 | U | P | -4.155 |
9 | A | P | -3.879 |
10 | G | P | -3.762 |
11 | U | P | -3.896 |
12 | G | P | -3.629 |
13 | U | P | -3.2 |
14 | C | P | -3.595 |
15 | U | P | -3.137 |
16 | A | P | -3.653 |
17 | A | P | -3.823 |
18 | A | P | -4.058 |
19 | C | P | -4.023 |
20 | G | P | -3.735 |
21 | G | P | -3.924 |
22 | U | P | -3.8 |
23 | U | P | -2.938 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 199 | 180 | 90.5 |
13C chemical shifts | 155 | 151 | 97.4 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 138 | 134 | 97.1 |
13C chemical shifts | 115 | 111 | 96.5 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 61 | 46 | 75.4 |
13C chemical shifts | 40 | 40 | 100.0 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 16 | 16 | 100.0 |
13C chemical shifts | 16 | 16 | 100.0 |
Distance restraints
--------10--------20--- GCAUGUUUAGUGUCUAAACGGUU |||||| |||||| ....GUUUAG...CUAAAC --------10---------
Dihedral angle restraints
--------10--------20--- GCAUGUUUAGUGUCUAAACGGUU ||||||||||| ||||||| GCAUGUUUAGU...UAAACGG --------10--------20-
RDC restraints
--------10--------20--- GCAUGUUUAGUGUCUAAACGGUU |||||||||||||| |||||||| GCAUGUUUAGUGUC.AAACGGUU