NMR structure of the II-III-VI three-way junction from the VS ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement
Polymer type: polyribonucleotide
Total | 1H | 13C | 15N | |
---|---|---|---|---|
All | 93.4 % (921 of 986) | 92.4 % (502 of 543) | 95.2 % (394 of 414) | 86.2 % (25 of 29) |
Suger, PO4 | 91.9 % (627 of 682) | 90.6 % (337 of 372) | 93.5 % (290 of 310) | |
Nucleobase | 96.7 % (294 of 304) | 96.5 % (165 of 171) | 100.0 % (104 of 104) | 86.2 % (25 of 29) |
Aromatic | 97.0 % (258 of 266) | 97.0 % (129 of 133) | 100.0 % (104 of 104) | 86.2 % (25 of 29) |
1. RNA (62-MER)
GCAGCAGGGA ACUCACGCUU GCGUAGAGGC UAAGUGCUUC GGCACAGCAC AAGCCCGCUG CGSolvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
32 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
33 | D2O | natural abundance | 10 % | |
34 | H2O | natural abundance | 90 % | |
35 | NaCacodylate | natural abundance | 10 mM | |
36 | KCl | natural abundance | 50 mM | |
37 | NaN3 | natural abundance | 0.05 mM | |
38 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | RNA (62-MER) | [U-15N] | 2 mM | |
2 | D2O | natural abundance | 10 % | |
3 | H2O | natural abundance | 90 % | |
4 | NaCacodylate | natural abundance | 10 mM | |
5 | KCl | natural abundance | 50 mM | |
6 | NaN3 | natural abundance | 0.05 mM | |
7 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
32 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
33 | D2O | natural abundance | 10 % | |
34 | H2O | natural abundance | 90 % | |
35 | NaCacodylate | natural abundance | 10 mM | |
36 | KCl | natural abundance | 50 mM | |
37 | NaN3 | natural abundance | 0.05 mM | |
38 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
32 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
33 | D2O | natural abundance | 10 % | |
34 | H2O | natural abundance | 90 % | |
35 | NaCacodylate | natural abundance | 10 mM | |
36 | KCl | natural abundance | 50 mM | |
37 | NaN3 | natural abundance | 0.05 mM | |
38 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
32 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
33 | D2O | natural abundance | 10 % | |
34 | H2O | natural abundance | 90 % | |
35 | NaCacodylate | natural abundance | 10 mM | |
36 | KCl | natural abundance | 50 mM | |
37 | NaN3 | natural abundance | 0.05 mM | |
38 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
8 | RNA (62-MER) | [U-13C; U-15N] | 2 mM | |
9 | D2O | natural abundance | 100 % | |
10 | NaCacodylate | natural abundance | 10 mM | |
11 | KCl | natural abundance | 50 mM | |
12 | NaN3 | natural abundance | 0.05 mM | |
13 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
14 | RNA (62-MER) | [U-13C; U-15N]-Ade | 2 mM | |
15 | D2O | natural abundance | 100 % | |
16 | NaCacodylate | natural abundance | 10 mM | |
17 | KCl | natural abundance | 50 mM | |
18 | NaN3 | natural abundance | 0.05 mM | |
19 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
20 | RNA (62-MER) | [U-13C; U-15N]-Cyt | 2 mM | |
21 | D2O | natural abundance | 100 % | |
22 | NaCacodylate | natural abundance | 10 mM | |
23 | KCl | natural abundance | 50 mM | |
24 | NaN3 | natural abundance | 0.05 mM | |
25 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Varian Unity - 600 MHz
State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 273 K, pH 6.5
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
26 | RNA (62-MER) | [U-13C; U-15N]-Gua | 2.5 mM | |
27 | D2O | natural abundance | 100 % | |
28 | NaCacodylate | natural abundance | 10 mM | |
29 | KCl | natural abundance | 50 mM | |
30 | NaN3 | natural abundance | 0.05 mM | |
31 | MgCl2 | natural abundance | 5 mM |
Properties
Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints | combined_25655_2n3r.nef |
Input source #2: Coordindates | 2n3r.cif |
Diamagnetism of the molecular assembly | False (excluding Oxygen atoms) |
Whether the assembly has a disulfide bond | None |
Whether the assembly has a other bond | True (see coodinates for details) |
Whether the assembly contains a cyclic polymer | None |
Overall data processing status | Error |
Disulfide bonds
NoneOther bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)
Ptnr_site_1 | Ptnr_site_2 | Redox_state_prediction_1 | Redox_state_prediction_2 | Distance (Ã…) |
---|---|---|---|---|
G:null:MG:MG | J:null:HOH:O | 1.838 | ||
D:null:MG:MG | J:null:HOH:O | 1.838 | ||
E:null:MG:MG | J:null:HOH:O | 1.838 | ||
C:null:MG:MG | J:null:HOH:O | 1.839 | ||
H:null:MG:MG | J:null:HOH:O | 1.839 | ||
I:null:MG:MG | J:null:HOH:O | 1.839 | ||
E:null:MG:MG | J:null:HOH:O | 1.839 | ||
F:null:MG:MG | J:null:HOH:O | 1.839 | ||
B:null:MG:MG | J:null:HOH:O | 1.839 | ||
B:null:MG:MG | J:null:HOH:O | 1.839 | ||
I:null:MG:MG | J:null:HOH:O | 1.839 | ||
D:null:MG:MG | J:null:HOH:O | 1.839 | ||
H:null:MG:MG | J:null:HOH:O | 1.839 | ||
H:null:MG:MG | J:null:HOH:O | 1.839 | ||
F:null:MG:MG | J:null:HOH:O | 1.84 | ||
C:null:MG:MG | J:null:HOH:O | 1.84 | ||
G:null:MG:MG | J:null:HOH:O | 1.84 | ||
G:null:MG:MG | J:null:HOH:O | 1.84 | ||
C:null:MG:MG | J:null:HOH:O | 1.84 | ||
F:null:MG:MG | J:null:HOH:O | 1.84 | ||
F:null:MG:MG | J:null:HOH:O | 1.84 | ||
E:null:MG:MG | J:null:HOH:O | 1.84 | ||
C:null:MG:MG | J:null:HOH:O | 1.84 | ||
G:null:MG:MG | J:null:HOH:O | 1.84 | ||
E:null:MG:MG | J:null:HOH:O | 1.84 | ||
D:null:MG:MG | J:null:HOH:O | 1.84 | ||
B:null:MG:MG | J:null:HOH:O | 1.84 | ||
D:null:MG:MG | J:null:HOH:O | 1.84 | ||
I:null:MG:MG | J:null:HOH:O | 1.84 | ||
H:null:MG:MG | J:null:HOH:O | 1.84 | ||
B:null:MG:MG | J:null:HOH:O | 1.841 | ||
B:null:MG:MG | J:null:HOH:O | 1.841 | ||
I:null:MG:MG | J:null:HOH:O | 1.841 | ||
I:null:MG:MG | J:null:HOH:O | 1.841 | ||
C:null:MG:MG | J:null:HOH:O | 1.841 | ||
F:null:MG:MG | J:null:HOH:O | 1.841 | ||
F:null:MG:MG | J:null:HOH:O | 1.841 | ||
H:null:MG:MG | J:null:HOH:O | 1.841 | ||
G:null:MG:MG | J:null:HOH:O | 1.841 | ||
B:null:MG:MG | J:null:HOH:O | 1.841 | ||
I:null:MG:MG | J:null:HOH:O | 1.841 | ||
H:null:MG:MG | J:null:HOH:O | 1.841 | ||
G:null:MG:MG | J:null:HOH:O | 1.841 | ||
E:null:MG:MG | J:null:HOH:O | 1.841 | ||
E:null:MG:MG | J:null:HOH:O | 1.841 | ||
D:null:MG:MG | J:null:HOH:O | 1.841 | ||
C:null:MG:MG | J:null:HOH:O | 1.841 | ||
D:null:MG:MG | J:null:HOH:O | 1.842 |
Non-standard residues
Chain_ID | Seq_ID | Comp_ID | Chem_comp_name | Experimental evidences |
---|---|---|---|---|
B | 1 | MG | MAGNESIUM ION | None |
B | 2 | MG | MAGNESIUM ION | None |
B | 3 | MG | MAGNESIUM ION | None |
B | 4 | MG | MAGNESIUM ION | None |
B | 5 | MG | MAGNESIUM ION | None |
B | 6 | MG | MAGNESIUM ION | None |
B | 7 | MG | MAGNESIUM ION | None |
B | 8 | MG | MAGNESIUM ION | None |
Sequence alignments
--------10--------20--------30--------40--------50--------60-- GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG
Chain assignments
Entity_assembly_ID (NMR) | Auth_asym_ID (model) | Length | Unmapped | Conflict | Sequence coverage (%) |
---|---|---|---|---|---|
A | A | 62 | 0 | 0 | 100.0 |
Content subtype: combined_25655_2n3r.nef
Assigned chemical shifts
--------10--------20--------30--------40--------50--------60-- GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG
Comp_index_ID | Comp_ID | Atom_ID | CS value (ppm) |
---|---|---|---|
2 | C | N4 | 98.84 |
5 | C | N4 | 97.86 |
10 | A | H61 | 6.526 |
10 | A | N6 | 71.934 |
12 | C | N4 | 97.178 |
14 | C | N4 | 98.528 |
16 | C | N4 | 97.648 |
18 | C | N4 | 95.751 |
22 | C | N4 | 96.259 |
25 | A | H61 | 6.003 |
25 | A | N6 | 78.691 |
26 | G | H21 | 5.657 |
26 | G | N2 | 71.316 |
28 | G | H21 | 8.56 |
28 | G | H22 | 8.034 |
28 | G | N2 | 78.113 |
30 | C | N4 | 97.067 |
37 | C | N4 | 99.384 |
40 | C | N4 | 93.721 |
43 | C | N4 | 97.789 |
45 | C | N4 | 95.592 |
48 | C | N4 | 97.672 |
50 | C | N4 | 69.955 |
51 | A | H61 | 6.813 |
51 | A | N6 | 78.673 |
52 | A | H61 | 6.875 |
52 | A | N6 | 78.207 |
53 | G | H21 | 7.859 |
53 | G | H22 | 6.359 |
53 | G | N2 | 81.428 |
54 | C | N4 | 97.969 |
55 | C | N4 | 97.742 |
56 | C | N4 | 98.029 |
58 | C | N4 | 99.385 |
61 | C | N4 | 98.52 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 543 | 502 | 92.4 |
13C chemical shifts | 414 | 394 | 95.2 |
15N chemical shifts | 29 | 25 | 86.2 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 372 | 337 | 90.6 |
13C chemical shifts | 310 | 290 | 93.5 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 171 | 165 | 96.5 |
13C chemical shifts | 104 | 104 | 100.0 |
15N chemical shifts | 29 | 25 | 86.2 |
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|
Atom group | # of target shifts | # of assigned shifts | Completeness (%) |
---|---|---|---|
1H chemical shifts | 48 | 48 | 100.0 |
13C chemical shifts | 48 | 48 | 100.0 |
Distance restraints
--------10--------20--------30--------40--------50--------60-- GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG
Dihedral angle restraints
--------10--------20--------30--------40--------50--------60-- GCAGCAGGGAACUCACGCUUGCGUAGAGGCUAAGUGCUUCGGCACAGCACAAGCCCGCUGCG ||||||||||| |||||||||||||||||||| ||||||| |||||||| ||||||||| GCAGCAGGGAA.UCACGCUUGCGUAGAGGCUA.GUGCUUC.GCACAGCA....CCCGCUGCG