Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): X vs Auth_asym_ID (model): X

Chain assignments

Content subtype: combined_25811_2n7m.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list_1
   • Status: OK
   • Sequence coverage of experimental data
     • Entity_assembly_ID: X, Chain length: 92, Sequence coverage: 32.6%
   • Total number of assignments
     • ¹H chemical shifts: 30
     • ¹⁵N chemical shifts: 25
     • ¹³C chemical shifts: 5
   • Completeness of assignments
   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: CNS/XPLOR_distance_constraints_2
   • Status: OK
   • Experiment type: noe
   • Sequence coverage of experimental data
     • Entity_assembly_ID: X, Chain length: 92, Sequence coverage: 70.7%

     0--------10--------20--------30--------40--------50--------60--------70--------80--------90-
     GGCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUGUAAAUCAGCAGUUCCCCUGCAUAAGGCU
      |  ||||| | |||||  | | | |||||||||||||||||||||||||| |    | |||||||||| ||   ||    || ||||||  
     .G..UUAUG.A.GGGAA..A.G.A.AUCAGUGAGGAUUCGUCCGAGAUUGU.U....G.UGGUGUAAAU.AG...UU....UG.AUAAGG  
     0--------10--------20--------30--------40--------50--------60--------70--------80---------  
     

   • Total number of restraints: 685
     • Intra-residue restraints, i = j : 359
     • Sequential restraints, | i - j | = 1 : 266
       • Backbone-backbone: 146
       • Backbone-side chain: 87
       • Side chain-side chain: 33
     • Medium range restraints, 1 < | i - j | < 5 : 21
       • Backbone-backbone: 3
       • Backbone-side chain: 12
       • Side chain-side chain: 6
     • Long range restraints, | i - j | >= 5 : 39
   • Weight of restraints: 1.0 (685)
     • Intra-residue restraints, i = j : 1.0 (359)
     • Sequential restraints, | i - j | = 1 : 1.0 (266)
       • Backbone-backbone: 1.0 (146)
       • Backbone-side chain: 1.0 (87)
       • Side chain-side chain: 1.0 (33)
     • Medium range restraints, 1 < | i - j | < 5 : 1.0 (21)
       • Backbone-backbone: 1.0 (3)
       • Backbone-side chain: 1.0 (12)
       • Side chain-side chain: 1.0 (6)
     • Long range restraints, | i - j | >= 5 : 1.0 (39)
   • Potential type of restraints: square-well-parabolic (685)
     • Intra-residue restraints, i = j : square-well-parabolic (359)
     • Sequential restraints, | i - j | = 1 : square-well-parabolic (266)
       • Backbone-backbone: square-well-parabolic (146)
       • Backbone-side chain: square-well-parabolic (87)
       • Side chain-side chain: square-well-parabolic (33)
     • Medium range restraints, 1 < | i - j | < 5 : square-well-parabolic (21)
       • Backbone-backbone: square-well-parabolic (3)
       • Backbone-side chain: square-well-parabolic (12)
       • Side chain-side chain: square-well-parabolic (6)
     • Long range restraints, | i - j | >= 5 : square-well-parabolic (39)
   • Range of distance target values: 2.25, 6.0 (Å)
   • Histogram of distance target values
   • Histogram of discrepancy in distance target values
   • Distance restraints per residue
     • Chain_ID: X
   • Distance restraints on contact map
     • Chain_ID_1: X - Chain_ID_2: X