Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

-20-------30--------40-
GGUAGUUUUGGCAUGACUCUACC
|||||||||||||||||||||||
GGUAGUUUUGGCAUGACUCUACC
--------10--------20---

Chain assignments

Content subtype: combined_25826_2n7x.nef

Assigned chemical shifts

1. Saveframe: assigned_chem_shift_list_1
   • Status: OK
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%

     -20-------30--------40-
     GGUAGUUUUGGCAUGACUCUACC
     |||||||||||||||||||||||
     GGUAGUUUUGGCAUGACUCUACC
     

   • Total number of assignments
     • ¹H chemical shifts: 175
     • ¹³C chemical shifts: 153
   • Completeness of assignments
     • Entity_assemble_ID: A
       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	202	175	86.6
         13C chemical shifts	155	153	98.7

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	138	135	97.8
         13C chemical shifts	115	113	98.3

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	64	40	62.5
         13C chemical shifts	40	40	100.0

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	14	14	100.0
         13C chemical shifts	14	14	100.0

   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: DYANA/DIANA_distance_constraints_2
   • Status: OK
   • Experiment type: noe
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%

     -20-------30--------40-
     GGUAGUUUUGGCAUGACUCUACC
     |||||||||||||||||||||||
     GGUAGUUUUGGCAUGACUCUACC
     

   • Total number of restraints: 596
     • Intra-residue restraints, i = j : 329
     • Sequential restraints, | i - j | = 1 : 191
       • Backbone-backbone: 35
       • Backbone-side chain: 116
       • Side chain-side chain: 40
     • Medium range restraints, 1 < | i - j | < 5 : 8
       • Backbone-backbone: 1
       • Backbone-side chain: 5
       • Side chain-side chain: 2
     • Long range restraints, | i - j | >= 5 : 68
   • Weight of restraints: 1.0 (596)
     • Intra-residue restraints, i = j : 1.0 (329)
     • Sequential restraints, | i - j | = 1 : 1.0 (191)
       • Backbone-backbone: 1.0 (35)
       • Backbone-side chain: 1.0 (116)
       • Side chain-side chain: 1.0 (40)
     • Medium range restraints, 1 < | i - j | < 5 : 1.0 (8)
       • Backbone-backbone: 1.0 (1)
       • Backbone-side chain: 1.0 (5)
       • Side chain-side chain: 1.0 (2)
     • Long range restraints, | i - j | >= 5 : 1.0 (68)
   • Potential type of restraints: upper-bound-parabolic (596)
     • Intra-residue restraints, i = j : upper-bound-parabolic (329)
     • Sequential restraints, | i - j | = 1 : upper-bound-parabolic (191)
       • Backbone-backbone: upper-bound-parabolic (35)
       • Backbone-side chain: upper-bound-parabolic (116)
       • Side chain-side chain: upper-bound-parabolic (40)
     • Medium range restraints, 1 < | i - j | < 5 : upper-bound-parabolic (8)
       • Backbone-backbone: upper-bound-parabolic (1)
       • Backbone-side chain: upper-bound-parabolic (5)
       • Side chain-side chain: upper-bound-parabolic (2)
     • Long range restraints, | i - j | >= 5 : upper-bound-parabolic (68)
   • Range of distance target values: 3.0, 6.5 (Å)
   • Histogram of distance target values
   • Histogram of discrepancy in distance target values
   • Distance restraints per residue
     • Chain_ID: A
   • Distance restraints on contact map
     • Chain_ID_1: A - Chain_ID_2: A
   • Saveframe: DYANA/DIANA_distance_constraints_4
     • Status: OK
     • Experiment type: hbond
     • Sequence coverage of experimental data
       • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 69.6%

       -20-------30--------40-
       GGUAGUUUUGGCAUGACUCUACC
       |||||| ||     || ||||||
       GGUAGU.UU.....GA.UCUACC
       

     • Total number of restraints: 38
       • Total hydrogen bond restraints: 38
     • Weight of restraints: 1.0 (38)
       • Total hydrogen bond restraints: 1.0 (38)
     • Potential type of restraints: upper-bound-parabolic (38)
       • Total hydrogen bond restraints: upper-bound-parabolic (38)
     • Range of distance target values: 2.0, 3.0 (Å)
     • Histogram of distance target values
     • Distance restraints per residue
       • Chain_ID: A
     • Distance restraints on contact map
       • Chain_ID_1: A - Chain_ID_2: A

Dihedral angle restraints

1. Saveframe: DYANA/DIANA_dihedral_3
   • Status: OK
   • Experiment type: .
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 91.3%

     -20-------30--------40-
     GGUAGUUUUGGCAUGACUCUACC
      ||||||||||||||||||||| 
     .GUAGUUUUGGCAUGACUCUAC 
     -20-------30--------40 
     

   • Total number of restraints: 63
     • Delta angle constraints: 21
     • Nu2 angle constraints: 21
     • Nu1 angle constraints: 21
   • Total number of restraints per polymer type: 63
     • Nucleic acid: 63
   • Weight of restraints: 1.0 (63)
     • Delta angle constraints: 1.0 (21)
     • Nu2 angle constraints: 1.0 (21)
     • Nu1 angle constraints: 1.0 (21)
   • Potential type of restraints: square-well-parabolic (63)
     • Delta angle constraints: square-well-parabolic (21)
     • Nu2 angle constraints: square-well-parabolic (21)
     • Nu1 angle constraints: square-well-parabolic (21)
   • Dihedral angle restraints per residue
     • Chain_ID: A