BMRBj - BMREntryMaster

Found 1 Document (0.359 seconds)

BMRB: 25997

2NBY

Solution structure of the J domain of EMCV IRES

Authors

Imai, S., D'Souza, V., Wagner, G.

Assembly

J domain of EMCV IRES

Entity

1. J domain of EMCV IRES (polymer, Thiol state: not present), 39 monomers, 12601.44 Da Detail

GGGCAGAAGG UACCCCAUUG UAUGGGAUCU GAUCUGCCC

Formula weight

12601.44 Da

Source organism

Encephalomyocarditis virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 97.4 %, Completeness: 49.3 %, Completeness (bb): 39.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	49.3 % (297 of 602)	45.2 % (154 of 341)	54.8 % (143 of 261)
Suger, PO4	39.9 % (171 of 429)	38.5 % (90 of 234)	41.5 % (81 of 195)
Nucleobase	72.8 % (126 of 173)	59.8 % (64 of 107)	93.9 % (62 of 66)
Aromatic	82.4 % (126 of 153)	73.6 % (64 of 87)	93.9 % (62 of 66)

1. RNA (39-MER)

GGGCAGAAGG UACCCCAUUG UAUGGGAUCU GAUCUGCCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (39-MER)	natural abundance	RNA	0.5 mM
2	potassium phosphate	natural abundance	buffer	10 mM
3	sodium chloride	natural abundance	salt	10 mM
4	D2O	[U-2H]	solvent	100 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (39-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (39-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

Release date

2016-08-07

Citation

An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation
Imai, S., Hellen, C., D'Souza, V., Wagner, G.
Nat. Struct. Mol. Biol. (2016), 23, 859-864, PubMed 27525590 , DOI 10.1038/nsmb.3280 , Abstract

Experiments performed 11 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (39-MER)	natural abundance	RNA	0.5 mM
2	potassium phosphate	natural abundance	buffer	10 mM
3	sodium chloride	natural abundance	salt	10 mM
4	D2O	[U-2H]	solvent	100 %

2 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
5	RNA (39-MER)	natural abundance	RNA	0.5 mM
6	potassium phosphate	natural abundance	buffer	10 mM
7	sodium chloride	natural abundance	salt	10 mM
8	H2O	natural abundance	solvent	90 %
9	D2O	[U-2H]	solvent	10 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
5	RNA (39-MER)	natural abundance	RNA	0.5 mM
6	potassium phosphate	natural abundance	buffer	10 mM
7	sodium chloride	natural abundance	salt	10 mM
8	H2O	natural abundance	solvent	90 %
9	D2O	[U-2H]	solvent	10 %

4 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (39-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

5 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (39-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

6 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (39-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

7 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (39-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

8 2D 1H-15N HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
18	RNA (39-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
19	potassium phosphate	natural abundance	buffer	10 mM
20	sodium chloride	natural abundance	salt	10 mM
21	H2O	natural abundance	solvent	90 %
22	D2O	[U-2H]	solvent	10 %

9 2D 1H-15N HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
18	RNA (39-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
19	potassium phosphate	natural abundance	buffer	10 mM
20	sodium chloride	natural abundance	salt	10 mM
21	H2O	natural abundance	solvent	90 %
22	D2O	[U-2H]	solvent	10 %

10 2D 1H-15N HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
23	RNA (39-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
24	potassium phosphate	natural abundance	buffer	10 mM
25	sodium chloride	natural abundance	salt	10 mM
26	H2O	natural abundance	solvent	90 %
27	D2O	[U-2H]	solvent	10 %

11 2D 1H-15N HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
23	RNA (39-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
24	potassium phosphate	natural abundance	buffer	10 mM
25	sodium chloride	natural abundance	salt	10 mM
26	H2O	natural abundance	solvent	90 %
27	D2O	[U-2H]	solvent	10 %

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_25997_2nby.nef
Input source #2: Coordindates	2nby.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

-----700-------710-------720-------730-
GGGCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGCCC
|||||||||||||||||||||||||||||||||||||||
GGGCAGAAGGUACCCCAUUGUAUGGGAUCUGAUCUGCCC
--------10--------20--------30---------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	39	0	0	100.0

Content subtype: combined_25997_2nby.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	OK	297		97.4 (chain: A, length: 39)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	321 (1)	noe	100.0 (chain: A, length: 39)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	105 (1)	hbond	82.1 (chain: A, length: 39)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	229 (229)	.	97.4 (chain: A, length: 39)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: OK
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 39, Sequence coverage: 97.4%
- Total number of assignments
  - ¹H chemical shifts: 154
  - ¹³C chemical shifts: 143
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	341	154	45.2
¹³C chemical shifts	261	143	54.8

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	234	90	38.5
¹³C chemical shifts	195	81	41.5

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	107	64	59.8
¹³C chemical shifts	66	62	93.9

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	28	28	100.0
¹³C chemical shifts	28	26	92.9

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 39, Sequence coverage: 100.0%
- Total number of restraints: 321
- Weight of restraints: 1.0 (321)
- Potential type of restraints: square-well-parabolic (321)
- Range of distance target values: 1.95, 7.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 39, Sequence coverage: 82.1%
  - Total number of restraints: 105
  - Weight of restraints: 1.0 (105)
  - Potential type of restraints: square-well-parabolic (105)
  - Range of distance target values: 1.61, 7.3 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 39, Sequence coverage: 97.4%
- Total number of restraints: 229
- Total number of restraints per polymer type: 229
- Weight of restraints: 1.0 (229)
- Potential type of restraints: square-well-parabolic (229)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords IRES, Viral RNA, translation initiation

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.359 seconds)

BMRB: 25997

Sample #1

Sample #2

Sample #3

Experiments performed 11 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail