BMRBj - BMREntryMaster

Found 1 Document (0.451 seconds)

BMRB: 25999

2NC0

Solution structure of the St domain of EMCV IRES

Authors

Imai, S., D'Souza, V., Wagner, G.

Assembly

St domain of EMCV IRES

Entity

1. St domain of EMCV IRES (polymer, Thiol state: not present), 28 monomers, 9191.471 Da Detail

GGGCUGAAGG AUGGAGACGU CUAGGCCC

Formula weight

9191.471 Da

Source organism

Encephalomyocarditis virus

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 83.0 %, Completeness (bb): 85.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	83.0 % (352 of 424)	78.3 % (188 of 240)	89.1 % (164 of 184)
Suger, PO4	85.7 % (264 of 308)	85.7 % (144 of 168)	85.7 % (120 of 140)
Nucleobase	75.9 % (88 of 116)	61.1 % (44 of 72)	100.0 % (44 of 44)
Aromatic	84.6 % (88 of 104)	73.3 % (44 of 60)	100.0 % (44 of 44)

1. RNA (28-MER)

GGGCUGAAGG AUGGAGACGU CUAGGCCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	natural abundance	RNA	0.5 mM
2	potassium phosphate	natural abundance	buffer	10 mM
3	sodium chloride	natural abundance	salt	10 mM
4	D2O	[U-2H]	solvent	100 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (28-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (28-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

Release date

2016-08-07

Citation

An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation
Imai, S., Hellen, C., D'Souza, V., Wagner, G.
Nat. Struct. Mol. Biol. (2016), 23, 859-864, PubMed 27525590 , DOI 10.1038/nsmb.3280 , Abstract

Entries sharing articles BMRB: 4 entries Detail

  BMRB: 25996 released on 2016-08-07
    Title Solution structure of the J-K region of EMCV IRES
  BMRB: 25997 released on 2016-08-07
    Title Solution structure of the J domain of EMCV IRES
  BMRB: 25998 released on 2016-08-07
    Title Solution structure of the K domain of EMCV IRES
  BMRB: 26000 released on 2016-08-07
    Title Solution structure of the delta-J-delta-K domain of EMCV IRES

Experiments performed 11 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	natural abundance	RNA	0.5 mM
2	potassium phosphate	natural abundance	buffer	10 mM
3	sodium chloride	natural abundance	salt	10 mM
4	D2O	[U-2H]	solvent	100 %

2 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance	RNA	0.5 mM
6	potassium phosphate	natural abundance	buffer	10 mM
7	sodium chloride	natural abundance	salt	10 mM
8	H2O	natural abundance	solvent	90 %
9	D2O	[U-2H]	solvent	10 %

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance	RNA	0.5 mM
6	potassium phosphate	natural abundance	buffer	10 mM
7	sodium chloride	natural abundance	salt	10 mM
8	H2O	natural abundance	solvent	90 %
9	D2O	[U-2H]	solvent	10 %

4 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (28-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

5 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
10	RNA (28-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
11	potassium phosphate	natural abundance	buffer	10 mM
12	sodium chloride	natural abundance	salt	10 mM
13	D2O	[U-2H]	solvent	100 %

6 2D 1H-13C HSQC

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (28-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

7 3D 1H-13C NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 308 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
14	RNA (28-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RNA	0.5 mM
15	potassium phosphate	natural abundance	buffer	10 mM
16	sodium chloride	natural abundance	salt	10 mM
17	D2O	[U-2H]	solvent	100 %

8 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
18	RNA (28-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
19	potassium phosphate	natural abundance	buffer	10 mM
20	sodium chloride	natural abundance	salt	10 mM
21	H2O	natural abundance	solvent	90 %
22	D2O	[U-2H]	solvent	10 %

9 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
18	RNA (28-MER)	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Cyt	RNA	0.5 mM
19	potassium phosphate	natural abundance	buffer	10 mM
20	sodium chloride	natural abundance	salt	10 mM
21	H2O	natural abundance	solvent	90 %
22	D2O	[U-2H]	solvent	10 %

10 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.5

#	Name	Isotope labeling	Type	Concentration
23	RNA (28-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RAN	0.5 mM
24	potassium phosphate	natural abundance	buffer	10 mM
25	sodium chloride	natural abundance	salt	10 mM
26	H2O	natural abundance	solvent	90 %
27	D2O	[U-2H]	solvent	10 %

11 2D 1H-15N HSQC

Instrument

Bruker Avance - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 5.5

#	Name	Isotope labeling	Type	Concentration
23	RNA (28-MER)	[U-13C; U-15N]-Gua, [U-13C; U-15N]-Ura	RAN	0.5 mM
24	potassium phosphate	natural abundance	buffer	10 mM
25	sodium chloride	natural abundance	salt	10 mM
26	H2O	natural abundance	solvent	90 %
27	D2O	[U-2H]	solvent	10 %

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_25999_2nc0.nef
Input source #2: Coordindates	2nc0.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

-------690---------780------
GGGCUGAAGGAUGGAGACGUCUAGGCCC
||||||||||||||||||||||||||||
GGGCUGAAGGAUGGAGACGUCUAGGCCC
--------10--------20--------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	28	0	0	100.0

Content subtype: combined_25999_2nc0.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	352		100.0 (chain: A, length: 28)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	229 (1)	noe	100.0 (chain: A, length: 28)
2	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	58 (1)	hbond	82.1 (chain: A, length: 28)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	140 (140)	.	89.3 (chain: A, length: 28)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 188
  - ¹³C chemical shifts: 164
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	240	188	78.3
¹³C chemical shifts	184	164	89.1

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	168	144	85.7
¹³C chemical shifts	140	120	85.7

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	72	44	61.1
¹³C chemical shifts	44	44	100.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	24	24	100.0
¹³C chemical shifts	24	24	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of restraints: 229
- Weight of restraints: 1.0 (229)
- Potential type of restraints: square-well-parabolic (229)
- Range of distance target values: 2.1, 8.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_4
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 82.1%
  - Total number of restraints: 58
  - Weight of restraints: 1.0 (58)
  - Potential type of restraints: square-well-parabolic (58)
  - Range of distance target values: 1.86, 3.63 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 89.3%
- Total number of restraints: 140
- Total number of restraints per polymer type: 140
- Weight of restraints: 1.0 (140)
- Potential type of restraints: square-well-parabolic (140)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords IRES, Viral RNA, translation initiation

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.451 seconds)

BMRB: 25999

Sample #1

Sample #2

Sample #3

Entries sharing articles BMRB: 4 entries Detail

Experiments performed 11 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail