BMRBj - BMREntryMaster

Found 1 Document (0.359 seconds)

BMRB: 26024

2NCI

RNA Bulge Loop that Specifically Binds Metal Ions

Authors

Gu, X., Schroeder, S.J.

Assembly

RNA (28-MER)

Entity

1. RNA (28-MER) (polymer, Thiol state: not available), 28 monomers, 9033.343 Da Detail

GGACGUUAAA AGGCUUCGGC CUACGUCC

Formula weight

9033.343 Da

Source organism

Bacteriophage sp.

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 58.5 %, Completeness (bb): 62.7 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	58.5 % (262 of 448)	74.8 % (184 of 246)	41.5 % (78 of 188)	0.0 % (0 of 14)
Suger, PO4	62.7 % (193 of 308)	81.0 % (136 of 168)	40.7 % (57 of 140)
Nucleobase	49.3 % (69 of 140)	61.5 % (48 of 78)	43.8 % (21 of 48)	0.0 % (0 of 14)
Aromatic	55.6 % (69 of 124)	77.4 % (48 of 62)	43.8 % (21 of 48)	0.0 % (0 of 14)

1. RNA (28-MER)

GGACGUUAAA AGGCUUCGGC CUACGUCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance		1 mM
6	cobalt hexamine	natural abundance		1 mM
7	sodium chloride	natural abundance		10 mM
8	sodium phosphate	natural abundance		10 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
9	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
10	cobalt hexamine	natural abundance		1.5 mM
11	phage	natural abundance		5 mg/mL
12	sodium chloride	natural abundance		10 mM
13	sodium phosphate	natural abundance		10 mM

Release date

2016-09-21

Citation

NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions
Gu, X., Park, S., Tonelli, M., Cornilescu, G., Xia, T., Zhong, D., Schroeder, S.J.
J. Phys. Chem. Lett. (2016), 3841-3846, PubMed 27631837 , DOI 10.1021/acs.jpclett.6b01465 , Abstract

Experiments performed 9 experiments Detail

1 2D 1H-13C HSQC

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

2 3D HCCH-TOCSY

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

3 2D NOESY13CHSQC

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

4 2D HCNTROSY

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

5 2D NOESY

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
1	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
2	cobalt hexamine	natural abundance		1.5 mM
3	sodium chloride	natural abundance		10 mM
4	sodium phosphate	natural abundance		10 mM

6 2D 1H-13C HSQC

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
9	RNA (28-MER)	[U-98% 13C; U-98% 15N]-A,U		1.5 mM
10	cobalt hexamine	natural abundance		1.5 mM
11	phage	natural abundance		5 mg/mL
12	sodium chloride	natural abundance		10 mM
13	sodium phosphate	natural abundance		10 mM

7 2D NOESY

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 bar, Temperature 274 K, pH 6

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance		1 mM
6	cobalt hexamine	natural abundance		1 mM
7	sodium chloride	natural abundance		10 mM
8	sodium phosphate	natural abundance		10 mM

8 2D COSY

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 bar, Temperature 274 K, pH 6

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance		1 mM
6	cobalt hexamine	natural abundance		1 mM
7	sodium chloride	natural abundance		10 mM
8	sodium phosphate	natural abundance		10 mM

9 2D 1H-13C HSQC

Instrument

Varian VNMRS - 500 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6

#	Name	Isotope labeling	Type	Concentration
5	RNA (28-MER)	natural abundance		1 mM
6	cobalt hexamine	natural abundance		1 mM
7	sodium chloride	natural abundance		10 mM
8	sodium phosphate	natural abundance		10 mM

NMR combined restraints 7 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_26024_2nci.nef
Input source #2: Coordindates	2nci.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Error

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------
GGACGUUAAAAGGCUUCGGCCUACGUCC
||||||||||||||||||||||||||||
GGACGUUAAAAGGCUUCGGCCUACGUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	28	0	0	100.0

Content subtype: combined_26024_2nci.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	273		100.0 (chain: A, length: 28)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	463 (1)	noe	100.0 (chain: A, length: 28)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	OK	50 (1)	hbond	64.3 (chain: A, length: 28)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	Error	183 (183)	.	78.6 (chain: A, length: 28)
2	Dihedral angle restraints	CNS/XPLOR_dihedral_6	Warning	72 (71)	.	25.0 (chain: A, length: 28)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_4	OK	29 (29)	.	39.3 (chain: A, length: 28)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 184
  - ¹³C chemical shifts: 78
  - ¹⁵N chemical shifts: 11
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 100.0%
- Total number of restraints: 463
- Weight of restraints: 1.0 (463)
- Potential type of restraints: square-well-parabolic (463)
- Range of distance target values: 2.1, 5.0 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 64.3%
  - Total number of restraints: 50
  - Weight of restraints: 1.0 (50)
  - Potential type of restraints: square-well-parabolic (50)
  - Range of distance target values: 2.0, 2.9 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: Error
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 78.6%
- Total number of restraints: 183
- Total number of restraints per polymer type: 183
- Weight of restraints: 1.0 (183)
- Potential type of restraints: square-well-parabolic (183)
- Dihedral angle restraints per residue
  - Chain_ID: A
- Saveframe: CNS/XPLOR_dihedral_6
  - Status: Warning
  - Experiment type: .
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 25.0%
  - Total number of restraints: 71
  - Total number of restraints per polymer type: 71
  - Weight of restraints: 1.0 (71)
  - Potential type of restraints: square-well-parabolic (71)
  - Dihedral angle restraints per residue

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 28, Sequence coverage: 39.3%
- Total number of restraints: 29
- Potential type of restraints: square-well-parabolic (29)
- Range of observed RDC values: -20.1, 23.9 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue

Keywords RNA, bulge loop, metal ion