BMRBj - BMREntryMaster

Found 1 Document (0.528 seconds)

BMRB: 26568

5A17

The structure of the SOLE element of oskar mRNA

Authors

Simon, B., Masiewicz, P., Ephrussi, A., Carlomagno, T.

Assembly

The structure of the SOLE element of oskar mRNA

Entity

1. The structure of the SOLE element of oskar mRNA (polymer, Thiol state: not present), 32 monomers, 10375.17 Da Detail

GACGAUAUCG AGCAUCAAGA GUGAAUAUCG UC

Formula weight

10375.17 Da

Source organism

Drosophila melanogaster

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 93.1 %, Completeness (bb): 97.4 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	93.1 % (501 of 538)	91.3 % (251 of 275)	98.6 % (213 of 216)	46.7 % (7 of 15)	93.8 % (30 of 32)
Suger, PO4	97.4 % (374 of 384)	97.4 % (187 of 192)	98.1 % (157 of 160)		93.8 % (30 of 32)
Nucleobase	82.5 % (127 of 154)	77.1 % (64 of 83)	100.0 % (56 of 56)	46.7 % (7 of 15)
Aromatic	89.4 % (127 of 142)	90.1 % (64 of 71)	100.0 % (56 of 56)	46.7 % (7 of 15)

1. OSKAR MRNA

GACGAUAUCG AGCAUCAAGA GUGAAUAUCG UC

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

Release date

2015-05-03

Citation

The structure of the SOLE element of oskar mRNA
Simon, B., Masiewicz, P., Ephrussi, A., Carlomagno, T.
RNA (2015), 21, 1444-1453, PubMed 26089324 , DOI 10.1261/rna.049601.115 , Abstract

Experiments performed 8 experiments Detail

1 HBCNB/HSCNB

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

2 HCCH-COSY-TOCSY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

3 3D EDITED NOESY

Instrument

Bruker Avance - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

4 HBCNB/HSCNB

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

5 HCCH-COSY-TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

6 3D 13C EDITED NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

7 2D NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

8 2D HNN-COSY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 308.000 K, pH 6.400, Details 0.3-0.4 mmol/l

#	Name	Isotope labeling	Type	Concentration
1	OSKAR MRNA	[U-13C; U-15N]		0.35 (±0.05) mM

NMR combined restraints 7 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_26568_5a17.nef
Input source #2: Coordindates	5a17.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--
GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC
||||||||||||||||||||||||||||||||
GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	32	0	0	100.0

Content subtype: combined_26568_5a17.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list	Warning	532		100.0 (chain: A, length: 32)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	691 (1)	noe	100.0 (chain: A, length: 32)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	176 (1)	noe	87.5 (chain: A, length: 32)
3	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	62 (1)	hbond	81.2 (chain: A, length: 32)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	206 (206)	.	93.8 (chain: A, length: 32)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_6	OK	76 (76)	.	100.0 (chain: A, length: 32)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%

--------10--------20--------30--
GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC
||||||||||||||||||||||||||||||||
GACGAUAUCGAGCAUCAAGAGUGAAUAUCGUC

Total number of assignments
- ¹H chemical shifts: 251
- ¹³C chemical shifts: 213
- ¹⁵N chemical shifts: 38
- ³¹P chemical shifts: 30

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	N9	167.6
1	G	P	-3.78
2	A	N9	170.7
2	A	P	-3.94
3	C	N1	150.0
3	C	P	-4.33
4	G	N9	168.7
4	G	P	-4.46
5	A	N9	170.5
6	U	N1	145.5
6	U	P	-1.08
7	A	N9	170.7
7	A	P	-4.25
8	U	N1	145.3
8	U	P	-4.63
9	C	N1	150.4
9	C	P	-4.45
10	G	N9	168.7
10	G	P	-4.13
11	A	N9	169.1
11	A	P	-4.09
12	G	N9	168.7
12	G	P	-4.08
13	C	P	-4.23
14	A	N9	169.1
14	A	P	-4.08
15	U	N1	143.6
15	U	P	-4.33
16	C	N1	150.6
16	C	P	-4.25
17	A	N9	168.3
17	A	P	-4.08
18	A	N9	168.3
18	A	P	-3.85
19	G	N9	167.9
19	G	P	-4.06
20	A	N9	168.5
20	A	P	-4.06
21	G	N9	168.7
21	G	P	-0.66
22	U	N1	146.1
23	G	N9	167.3
23	G	P	-4.25
24	A	N9	168.3
24	A	P	-4.14
25	A	N9	169.1
25	A	P	-4.48
26	U	N1	145.5
26	U	P	-4.25
27	A	N9	170.8
27	A	P	-4.48
28	U	N1	146.1
28	U	P	-4.63
29	C	N1	150.3
29	C	P	-4.08
30	G	N9	168.3
30	G	P	-4.25
31	U	N1	146.4
31	U	P	-4.98
32	C	N1	150.0
32	C	P	-4.56

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	275	251	91.3
¹³C chemical shifts	216	213	98.6
¹⁵N chemical shifts	15	7	46.7

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	192	187	97.4
¹³C chemical shifts	160	157	98.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	83	64	77.1
¹³C chemical shifts	56	56	100.0
¹⁵N chemical shifts	15	7	46.7

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	30	30	100.0
¹³C chemical shifts	30	30	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 691
- Weight of restraints: 1.0 (691)
- Potential type of restraints: square-well-parabolic (691)
- Range of distance target values: 2.2, 4.6 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: noe
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 87.5%
  - Total number of restraints: 175
  - Weight of restraints: 1.0 (175)
  - Potential type of restraints: square-well-parabolic (175)
  - Range of distance target values: 2.2, 4.6 (Å)
  - Histogram of distance target values
  - Histogram of discrepancy in distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map
  - Saveframe: CNS/XPLOR_distance_constraints_4
    - Status: Warning
    - Experiment type: hbond
    - Sequence coverage of experimental data
      - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 81.2%
    - Total number of restraints: 62
    - Weight of restraints: 1.0 (62)
    - Potential type of restraints: square-well-parabolic (62)
    - Range of distance target values: 1.71, 4.56 (Å)
    - Histogram of distance target values
    - Distance restraints per residue
      - Chain_ID: A
    - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 93.8%
- Total number of restraints: 206
- Total number of restraints per polymer type: 206
- Weight of restraints: 1.0 (206)
- Potential type of restraints: square-well-parabolic (206)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_6
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 32, Sequence coverage: 100.0%
- Total number of restraints: 76
- Potential type of restraints: undefined (76)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords RNA, SOLE element, oskar