BMRBj - BMREntryMaster

Found 1 Document (0.452 seconds)

BMRB: 27452

6HAG

NMR resonance assignment for the SAM/SAH binding riboswitch RNA bound to S-Adenosylhomocysteine

Authors

Weickhmann, A., Keller, H., Duchardt-Ferner, E., Wunderlich, C.H., Juen, M., Kremser, J., Kreutz, C., Woehnert, J.

Assembly

env9b SAH

Entity

1. env9b (polymer, Thiol state: not present), 43 monomers, 13896.21 Da Detail

GUCACAACGG CUUCCUGACG UGGCAGAUUG AAUUAUUGGA GCA

2. S-ADENOSYL-L-HOMOCYSTEINE (non-polymer), 384.411 Da

Total weight

14280.621 Da

Max. entity weight

13896.21 Da

Source organism

marine environmental probe

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 80.3 %, Completeness (bb): 74.8 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	80.3 % (550 of 685)	78.0 % (291 of 373)	84.4 % (244 of 289)	65.2 % (15 of 23)
Suger, PO4	74.8 % (354 of 473)	71.3 % (184 of 258)	79.1 % (170 of 215)
Nucleobase	92.5 % (196 of 212)	93.0 % (107 of 115)	100.0 % (74 of 74)	65.2 % (15 of 23)
Aromatic	91.8 % (178 of 194)	91.8 % (89 of 97)	100.0 % (74 of 74)	65.2 % (15 of 23)

1. env9b

GUCACAACGG CUUCCUGACG UGGCAGAUUG AAUUAUUGGA GCA

Show sample condition

Sample #1

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	env9b	[U-13C; U-15N]	710 uM
2	S-Adenosylhomocysteine	natural abundance	2 mM
3	potassium phosphate	natural abundance	25 mM
4	potassium chloride	natural abundance	50 mM
5	magnesium acetate	natural abundance	2 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	env9b	[U-15N]	910 uM
7	S-Adenosylhomocysteine	natural abundance	2.5 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	magnesium acetate	natural abundance	2 mM

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
16	env9b	[U-5-D1/ribose-3 ,4 ,5 ,5 -D4]	750 uM
17	S-Adenosylhomocysteine	natural abundance	3 mM
18	potassium phosphate	natural abundance	25 mM
19	potassium chloride	natural abundance	50 mM
20	magnesium acetate	natural abundance	2 mM

Sample #5

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
21	env9b	natural abundance	700 uM
22	S-Adenosylhomocysteine	[U-13C; U-15N]	0.5 mM
23	potassium phosphate	natural abundance	25 mM
24	potassium chloride	natural abundance	50 mM
25	magnesium acetate	natural abundance	2 mM

Sample #6

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

Sample #7

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

Sample #8

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
36	env9b	natural abundance	1.2 uM
37	S-Adenosylhomocysteine	natural abundance	4 mM
38	potassium phosphate	natural abundance	25 mM
39	potassium chloride	natural abundance	50 mM
40	magnesium acetate	natural abundance	2 mM

Sample #9

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

Sample #10

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
46	env9b	[U-13C; U-15N]-Ura	800 uM
47	S-Adenosylhomocysteine	natural abundance	1.6 mM
48	potassium phosphate	natural abundance	25 mM
49	potassium chloride	natural abundance	50 mM
50	magnesium acetate	natural abundance	2 mM

Sample #11

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
51	env9b	[U-13C; U-15N]-Gua	850 uM
52	S-Adenosylhomocysteine	natural abundance	2 mM
53	potassium phosphate	natural abundance	25 mM
54	potassium chloride	natural abundance	50 mM
55	magnesium acetate	natural abundance	2 mM

Sample #12

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
56	env9b	[U-13C; U-15N]-Ura	480 uM
57	S-Adenosylhomocysteine	[U-13C; U-15N]	750 mM
58	potassium phosphate	natural abundance	25 mM
59	potassium chloride	natural abundance	50 mM
60	magnesium acetate	natural abundance	2 mM

Release date

2018-04-15

Citation

NMR resonance assignments for the SAM/SAH-binding riboswitch RNA bound to S-adenosylhomocysteine
Weickhmann, A.K., Keller, H., Duchardt-Ferner, E., Strebitzer, E., Juen, M.A., Kremser, J., Wurm, J.P., Kreutz, C., Wohnert, J.
Biomol. NMR Assign. (2018), 12, 329-334, PubMed 30051308 , DOI 10.1007/s12104-018-9834-3 , Abstract

Experiments performed 48 experiments Detail

1 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	env9b	[U-13C; U-15N]	710 uM
2	S-Adenosylhomocysteine	natural abundance	2 mM
3	potassium phosphate	natural abundance	25 mM
4	potassium chloride	natural abundance	50 mM
5	magnesium acetate	natural abundance	2 mM

2 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

3 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

4 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

5 2D 1H-15N HSQC NH2 only

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	env9b	[U-15N]	910 uM
7	S-Adenosylhomocysteine	natural abundance	2.5 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	magnesium acetate	natural abundance	2 mM

6 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	env9b	[U-13C; U-15N]	710 uM
2	S-Adenosylhomocysteine	natural abundance	2 mM
3	potassium phosphate	natural abundance	25 mM
4	potassium chloride	natural abundance	50 mM
5	magnesium acetate	natural abundance	2 mM

7 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

8 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

9 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

10 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	env9b	[U-13C; U-15N]	710 uM
2	S-Adenosylhomocysteine	natural abundance	2 mM
3	potassium phosphate	natural abundance	25 mM
4	potassium chloride	natural abundance	50 mM
5	magnesium acetate	natural abundance	2 mM

11 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

12 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

13 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

14 2D 1H-1H NOESY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
36	env9b	natural abundance	1.2 uM
37	S-Adenosylhomocysteine	natural abundance	4 mM
38	potassium phosphate	natural abundance	25 mM
39	potassium chloride	natural abundance	50 mM
40	magnesium acetate	natural abundance	2 mM

15 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

16 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

17 3D 1H-13C NOESY aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

18 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

19 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
46	env9b	[U-13C; U-15N]-Ura	800 uM
47	S-Adenosylhomocysteine	natural abundance	1.6 mM
48	potassium phosphate	natural abundance	25 mM
49	potassium chloride	natural abundance	50 mM
50	magnesium acetate	natural abundance	2 mM

20 3D 1H-13C NOESY aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
51	env9b	[U-13C; U-15N]-Gua	850 uM
52	S-Adenosylhomocysteine	natural abundance	2 mM
53	potassium phosphate	natural abundance	25 mM
54	potassium chloride	natural abundance	50 mM
55	magnesium acetate	natural abundance	2 mM

21 2D 1H-1H NOESY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 271 K, pH 6.2

#	Name	Isotope labeling	Concentration
36	env9b	natural abundance	1.2 uM
37	S-Adenosylhomocysteine	natural abundance	4 mM
38	potassium phosphate	natural abundance	25 mM
39	potassium chloride	natural abundance	50 mM
40	magnesium acetate	natural abundance	2 mM

22 3D HCCH-TOCSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

23 3D HCCH-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

24 3D HCCH-TOCSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
46	env9b	[U-13C; U-15N]-Ura	800 uM
47	S-Adenosylhomocysteine	natural abundance	1.6 mM
48	potassium phosphate	natural abundance	25 mM
49	potassium chloride	natural abundance	50 mM
50	magnesium acetate	natural abundance	2 mM

25 3D HCCH-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
46	env9b	[U-13C; U-15N]-Ura	800 uM
47	S-Adenosylhomocysteine	natural abundance	1.6 mM
48	potassium phosphate	natural abundance	25 mM
49	potassium chloride	natural abundance	50 mM
50	magnesium acetate	natural abundance	2 mM

26 3D HCCH-TOCSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
51	env9b	[U-13C; U-15N]-Gua	850 uM
52	S-Adenosylhomocysteine	natural abundance	2 mM
53	potassium phosphate	natural abundance	25 mM
54	potassium chloride	natural abundance	50 mM
55	magnesium acetate	natural abundance	2 mM

27 3D HCCH-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
51	env9b	[U-13C; U-15N]-Gua	850 uM
52	S-Adenosylhomocysteine	natural abundance	2 mM
53	potassium phosphate	natural abundance	25 mM
54	potassium chloride	natural abundance	50 mM
55	magnesium acetate	natural abundance	2 mM

28 1D 1H-HS11ECHO

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
36	env9b	natural abundance	1.2 uM
37	S-Adenosylhomocysteine	natural abundance	4 mM
38	potassium phosphate	natural abundance	25 mM
39	potassium chloride	natural abundance	50 mM
40	magnesium acetate	natural abundance	2 mM

29 2D 1H-15N HNN-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
1	env9b	[U-13C; U-15N]	710 uM
2	S-Adenosylhomocysteine	natural abundance	2 mM
3	potassium phosphate	natural abundance	25 mM
4	potassium chloride	natural abundance	50 mM
5	magnesium acetate	natural abundance	2 mM

30 2D 1H-13C HNCO

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

31 2D 1H-13C HNCO

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

32 2D 1H-13C H5C5(C4N)H

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

33 2D 1H-15N HCN aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

34 2D 1H-15N HCN aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
46	env9b	[U-13C; U-15N]-Ura	800 uM
47	S-Adenosylhomocysteine	natural abundance	1.6 mM
48	potassium phosphate	natural abundance	25 mM
49	potassium chloride	natural abundance	50 mM
50	magnesium acetate	natural abundance	2 mM

35 2D 1H-15N 2bond-HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	env9b	[U-15N]	910 uM
7	S-Adenosylhomocysteine	natural abundance	2.5 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	magnesium acetate	natural abundance	2 mM

36 TROSY relayed HCCH-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

37 2D 1H-13C long-rangeH8(C8)C5(N1)H1

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

38 2D 1H-13C H5C5(C4N)H

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
11	env9b	[U-13C; U-15N]-Ura	800 uM
12	S-Adenosylhomocysteine	natural abundance	1.6 mM
13	potassium phosphate	natural abundance	25 mM
14	potassium chloride	natural abundance	50 mM
15	magnesium acetate	natural abundance	2 mM

39 2D 1H-15N HCN aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
26	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
27	S-Adenosylhomocysteine	natural abundance	2 mM
28	potassium phosphate	natural abundance	25 mM
29	potassium chloride	natural abundance	50 mM
30	magnesium acetate	natural abundance	2 mM

40 2D 1H-15N HCN aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
41	env9b	[U-13C; U-15N]-Ade, [U-13C; U-15N]-Ade	800 uM
42	S-Adenosylhomocysteine	natural abundance	2 mM
43	potassium phosphate	natural abundance	25 mM
44	potassium chloride	natural abundance	50 mM
45	magnesium acetate	natural abundance	2 mM

41 2D 1H-15N HCN aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
31	env9b	[U-13C; U-15N]-Gua	850 uM
32	S-Adenosylhomocysteine	natural abundance	2 mM
33	potassium phosphate	natural abundance	25 mM
34	potassium chloride	natural abundance	50 mM
35	magnesium acetate	natural abundance	2 mM

42 2D 1H-15N HCN aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
51	env9b	[U-13C; U-15N]-Gua	850 uM
52	S-Adenosylhomocysteine	natural abundance	2 mM
53	potassium phosphate	natural abundance	25 mM
54	potassium chloride	natural abundance	50 mM
55	magnesium acetate	natural abundance	2 mM

43 2D 1H-15N HNN-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.2

#	Name	Isotope labeling	Concentration
56	env9b	[U-13C; U-15N]-Ura	480 uM
57	S-Adenosylhomocysteine	[U-13C; U-15N]	750 mM
58	potassium phosphate	natural abundance	25 mM
59	potassium chloride	natural abundance	50 mM
60	magnesium acetate	natural abundance	2 mM

44 2D 1H-15N HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 271 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	env9b	[U-15N]	910 uM
7	S-Adenosylhomocysteine	natural abundance	2.5 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	magnesium acetate	natural abundance	2 mM

45 2D lr-1H,15N-HSQC

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
6	env9b	[U-15N]	910 uM
7	S-Adenosylhomocysteine	natural abundance	2.5 mM
8	potassium phosphate	natural abundance	25 mM
9	potassium chloride	natural abundance	50 mM
10	magnesium acetate	natural abundance	2 mM

46 2D 1H-13C HSQC aliphatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
21	env9b	natural abundance	700 uM
22	S-Adenosylhomocysteine	[U-13C; U-15N]	0.5 mM
23	potassium phosphate	natural abundance	25 mM
24	potassium chloride	natural abundance	50 mM
25	magnesium acetate	natural abundance	2 mM

47 2D 1H-13C HSQC aromatic

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
21	env9b	natural abundance	700 uM
22	S-Adenosylhomocysteine	[U-13C; U-15N]	0.5 mM
23	potassium phosphate	natural abundance	25 mM
24	potassium chloride	natural abundance	50 mM
25	magnesium acetate	natural abundance	2 mM

48 3D HCCH-COSY

Instrument

Bruker Avance - 950 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.2

#	Name	Isotope labeling	Concentration
21	env9b	natural abundance	700 uM
22	S-Adenosylhomocysteine	[U-13C; U-15N]	0.5 mM
23	potassium phosphate	natural abundance	25 mM
24	potassium chloride	natural abundance	50 mM
25	magnesium acetate	natural abundance	2 mM

NMR combined restraints 3 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_27452_6hag.nef
Input source #2: Coordindates	6hag.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	SAH	S-ADENOSYL-L-HOMOCYSTEINE	Assigned chemical shifts, Distance restraints

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40---
GUCACAACGGCUUCCUGACGUGGCAGAUUGAAUUAUUGGAGCA
|||||||||||||||||||||||||||||||||||||||||||
GUCACAACGGCUUCCUGACGUGGCAGAUUGAAUUAUUGGAGCA

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	43	0	0	100.0

Content subtype: combined_27452_6hag.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chem_shift_list_1	Warning	757		100.0 (chain: A, length: 43), 100.0 (chain: B, length: 1)
1	Distance restraints	DYANA/DIANA_distance_constraints_2	Warning	660 (1)	noe	76.7 (chain: A, length: 43), 100.0 (chain: B, length: 1)

Assigned chemical shifts

Saveframe: assigned_chem_shift_list_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 43, Sequence coverage: 100.0%

--------10--------20--------30--------40---
GUCACAACGGCUUCCUGACGUGGCAGAUUGAAUUAUUGGAGCA
|||||||||||||||||||||||||||||||||||||||||||
GUCACAACGGCUUCCUGACGUGGCAGAUUGAAUUAUUGGAGCA

Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%

-
X
|
X

Total number of assignments
- ¹H chemical shifts: 318
- ¹³C chemical shifts: 313
- ¹⁵N chemical shifts: 126

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	C2	150.886
1	G	C5	78.786
1	G	C6	156.067
1	G	N7	230.411
1	G	N9	167.552
2	U	C2	149.012
2	U	C4	161.371
3	C	N1	150.874
3	C	N3	195.158
3	C	N4	97.947
4	A	H62	7.918
4	A	H61	6.058
4	A	C4	143.046
4	A	C6	153.716
4	A	N1	220.725
4	A	N3	211.993
4	A	N6	84.334
4	A	N7	229.598
4	A	N9	169.827
5	C	N1	148.916
5	C	N3	194.553
5	C	N4	95.957
6	A	C4	143.478
6	A	C6	153.014
6	A	N1	223.619
6	A	N3	213.802
6	A	N7	229.215
6	A	N9	170.426
7	A	C4	142.912
7	A	C6	154.691
7	A	N1	221.403
7	A	N3	216.215
7	A	N7	236.629
7	A	N9	168.245
8	C	N1	151.067
8	C	N3	200.119
8	C	N4	94.612
9	G	C2	151.583
9	G	C5	115.007
9	G	C6	155.376
9	G	N7	236.52
9	G	N9	162.81
10	G	C2	151.177
10	G	C5	115.686
10	G	C6	156.754
10	G	N7	229.664
10	G	N9	167.344
11	C	N1	149.51
11	C	N3	196.184
11	C	N4	99.878
12	U	C2	148.598
12	U	C4	161.289
12	U	N1	138.691
13	U	N1	142.496
14	C	N1	149.941
14	C	N3	196.222
14	C	N4	100.196
15	C	N1	148.789
15	C	N3	196.069
15	C	N4	99.774
16	U	C2	147.996
16	U	C4	162.167
17	G	H21	7.973
17	G	C2	150.249
17	G	C5	112.818
17	G	C6	154.496
17	G	N2	75.603
17	G	N7	235.847
17	G	N9	168.145
18	A	C4	144.88
18	A	N3	216.495
18	A	N7	234.515
18	A	N9	166.757
19	C	N1	150.95
19	C	N3	198.498
19	C	N4	94.607
20	G	H22	8.671
20	G	H21	6.509
20	G	C2	151.07
20	G	C5	113.962
20	G	C6	156.42
20	G	N2	75.546
20	G	N7	222.345
20	G	N9	168.67
21	U	C2	146.992
21	U	C4	164.291
21	U	N1	142.474
22	G	H21	7.205
22	G	C2	150.174
22	G	C5	115.366
22	G	C6	156.304
22	G	N2	72.351
22	G	N7	233.759
22	G	N9	168.396
23	G	H21	6.141
23	G	H22	6.141
23	G	C2	150.053
23	G	C5	114.709
23	G	C6	155.493
23	G	N2	71.957
23	G	N7	231.768
23	G	N9	168.675
24	C	N1	149.767
24	C	N3	194.768
24	C	N4	98.313
25	A	C4	143.1
25	A	C6	152.852
25	A	N1	223.701
25	A	N3	214.314
25	A	N7	230.259
25	A	N9	168.716
26	G	N7	234.343
26	G	N9	167.257
27	A	C4	144.476
27	A	C6	153.877
27	A	N1	224.934
27	A	N3	215.077
27	A	N7	230.88
27	A	N9	168.4
28	U	N1	142.493
29	U	N1	142.828
30	G	N7	234.413
30	G	N9	167.11
31	A	C4	143.824
31	A	C6	153.384
31	A	N1	223.937
31	A	N3	214.88
31	A	N7	229.872
31	A	N9	167.82
32	A	C4	143.963
32	A	C6	153.886
32	A	N1	224.595
32	A	N3	214.78
32	A	N7	230.603
32	A	N9	168.596
33	U	N1	143.528
34	U	N1	143.287
35	A	H62	7.758
35	A	H61	7.01
35	A	C4	143.066
35	A	C6	154.723
35	A	N1	228.715
35	A	N3	206.807
35	A	N6	83.06
35	A	N9	168.729
37	U	N1	141.517
38	G	H21	7.928
38	G	C2	150.322
38	G	C5	115.095
38	G	C6	155.062
38	G	N2	71.329
38	G	N7	229.948
38	G	N9	166.518
39	G	H21	8.228
39	G	C2	150.199
39	G	C5	114.618
39	G	C6	154.881
39	G	N2	72.393
39	G	N7	233.042
39	G	N9	167.48
40	A	H62	8.475
40	A	H61	5.878
40	A	C4	141.438
40	A	C6	153.967
40	A	N1	222.49
40	A	N3	207.78
40	A	N6	84.014
40	A	N7	226.752
40	A	N9	169.971
41	G	C2	151.564
41	G	C5	114.69
41	G	C6	155.852
41	G	N7	233.135
41	G	N9	168.338
42	C	N1	149.18
42	C	N3	196.413
42	C	N4	97.695
43	A	C4	144.356
43	A	C6	153.905
43	A	N1	224.584
43	A	N3	214.956
43	A	N7	232.564
43	A	N9	166.743

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	373	291	78.0
¹³C chemical shifts	289	244	84.4
¹⁵N chemical shifts	23	15	65.2

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	258	184	71.3
¹³C chemical shifts	215	170	79.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	115	107	93.0
¹³C chemical shifts	74	74	100.0
¹⁵N chemical shifts	23	15	65.2

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	34	34	100.0
¹³C chemical shifts	34	34	100.0

Entity_assemble_ID: B

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: DYANA/DIANA_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 43, Sequence coverage: 76.7%
  - Entity_assembly_ID: B, Chain length: 1, Sequence coverage: 100.0%
- Total number of restraints: 660
- Weight of restraints: 1.0 (660)
- Potential type of restraints: upper-bound-parabolic (660)
- Range of distance target values: 4.4, 7.8 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
- Distance restraints on contact map

Keywords NMR-assignment, RNA, Riboswitch, S-Adenosylhomocysteine, S-Adenosylmethionine, Site-specific isotope labeling, Triple resonance experiments

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.452 seconds)

BMRB: 27452

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Sample #7

Sample #8

Sample #9

Sample #10

Sample #11

Sample #12

Experiments performed 48 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample