BMRBj - BMREntryMaster

Found 1 Document (0.416 seconds)

BMRB: 30012

5I2V

NMR structure of a new G-quadruplex forming sequence within the KRAS proto-oncogene promoter region

Authors

Salgado, G.F., Kerkour, A., Mergny, J.

Assembly

DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')

Entity

1. DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3') (polymer, Thiol state: not present), 22 monomers, 7049.484 Da Detail

AGGGCGGTGT GGGAATAGGG AA

2. POTASSIUM ION (non-polymer), 39.098 Da

Total weight

7088.582 Da

Max. entity weight

7049.484 Da

Source organism

Exptl. method

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 92.6 %, Completeness (bb): 96.1 % Detail

Polymer type: polydeoxyribonucleotide

	Total	¹H
All	92.6 % (188 of 203)	92.6 % (188 of 203)
Suger, PO4	96.1 % (148 of 154)	96.1 % (148 of 154)
Nucleobase	81.6 % (40 of 49)	81.6 % (40 of 49)
Aromatic	84.1 % (37 of 44)	84.1 % (37 of 44)
Methyl	100.0 % (3 of 3)	100.0 % (3 of 3)

1. DNA (5'-D(*AP*GP*GP*GP*CP*GP*GP*TP*GP*TP*GP*GP*GP*AP*AP*TP*AP*GP*GP*GP*AP*A)-3')

AGGGCGGTGT GGGAATAGGG AA

Show sample condition

Sample

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

Release date

2016-03-13

Citation

High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation
Kerkour, A., Marquevielle, J., Ivashchenko, S., Yatsunyk, L.A., Mergny, J.L., Salgado, G.F.
J. Biol. Chem. (2017), 292, 8082-8091, PubMed 28330874 , DOI 10.1074/jbc.M117.781906 , Abstract

Entries sharing articles BMRB: 1 entries Detail

BMRB: 27053 released on 2017-03-22
Title NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region

Experiments performed 8 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

2 2D 1H-1H COSY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

3 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

4 2D 1H-1H TOCSY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

5 2D 1H-15N HSQC

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

6 2D 1H-13C HMBC

Instrument

Bruker AvanceIII - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

7 1D 1H-15N HSQC

Instrument

Bruker AvanceIII - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

8 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 700 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 293 (±0.2) K, pH 6.6 (±0.1), Details 2 mM KRAS 22RT, 2 mM dG (5% 15N) KRAS 22RT 15N, 90% H2O/10% D2O

#	Name	Isotope labeling	Type	Concentration
1	KRAS 22RT	natural abundance		2 mM
2	KRAS 22RT 15N	dG (5% 15N)		2 mM
3	H2O	natural abundance		90 %
4	D2O	natural abundance		10 %

NMR combined restraints 3 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints	combined_30012_5i2v.nef
Input source #2: Coordindates	5i2v.cif
Diamagnetism of the molecular assembly	False (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:2:DG:O6	2:1:K:K	unknown	unknown	n/a
1:3:DG:O6	2:1:K:K	unknown	unknown	n/a
1:3:DG:O6	2:2:K:K	unknown	unknown	n/a
1:4:DG:O6	2:2:K:K	unknown	unknown	n/a
1:6:DG:O6	2:1:K:K	unknown	unknown	n/a
1:7:DG:O6	2:1:K:K	unknown	unknown	n/a
1:7:DG:O6	2:2:K:K	unknown	unknown	n/a
1:9:DG:O6	2:2:K:K	unknown	unknown	n/a
1:11:DG:O6	2:1:K:K	unknown	unknown	n/a
1:12:DG:O6	2:1:K:K	unknown	unknown	n/a
1:12:DG:O6	2:2:K:K	unknown	unknown	n/a
1:13:DG:O6	2:2:K:K	unknown	unknown	n/a
1:18:DG:O6	2:1:K:K	unknown	unknown	n/a
1:19:DG:O6	2:1:K:K	unknown	unknown	n/a
1:19:DG:O6	2:2:K:K	unknown	unknown	n/a
1:20:DG:O6	2:2:K:K	unknown	unknown	n/a

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
B	1	K	POTASSIUM ION	None
B	2	K	POTASSIUM ION	None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--
AGGGCGGTGTGGGAATAGGGAA
||||||||||||||||||||||
AGGGCGGTGTGGGAATAGGGAA

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	22	0	0	100.0

Content subtype: combined_30012_5i2v.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	16		No information
1	Assigned chemical shifts	assigned_chemical_shifts_1	OK	212		100.0 (chain: A, length: 22)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	OK	391 (1)	noe	100.0 (chain: A, length: 22)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: OK
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 212

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
2	DG	H22	9.383
2	DG	H21	6.543
3	DG	H22	9.397
3	DG	H21	6.549
4	DG	H22	8.852
4	DG	H21	6.599
6	DG	H21	6.325
6	DG	H22	9.405
7	DG	H22	9.212
7	DG	H21	6.766
9	DG	H22	8.616
9	DG	H21	6.1889
11	DG	H22	9.02
11	DG	H21	6.9146
12	DG	H22	9.203
12	DG	H21	6.333
13	DG	H22	8.716
13	DG	H21	6.8713
18	DG	H22	8.878
18	DG	H21	5.931
19	DG	H22	8.891
19	DG	H21	6.54
20	DG	H22	8.301
20	DG	H21	6.5871

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	203	188	92.6

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	154	148	96.1

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	49	40	81.6

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	3	3	100.0

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	24	20	83.3

Histogram of normalized assigned chemical shifts

Covalent bonds

Saveframe: assembly
- Status: OK

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 22, Sequence coverage: 100.0%
- Total number of restraints: 391
- Weight of restraints: 1.0 (391)
- Potential type of restraints: square-well-parabolic (391)
- Range of distance target values: 2.5, 5.25 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
  - Chain_ID: B
    None
- Distance restraints on contact map

Keywords DNA, G-quadruplex, KRAS, cancer target, proto-oncogene