DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium
Polymer type: polydeoxyribonucleotide
Total | 1H | |
---|---|---|
All | 92.0 % (172 of 187) | 92.0 % (172 of 187) |
Suger, PO4 | 94.3 % (132 of 140) | 94.3 % (132 of 140) |
Nucleobase | 85.1 % (40 of 47) | 85.1 % (40 of 47) |
Aromatic | 82.5 % (33 of 40) | 82.5 % (33 of 40) |
Methyl | 100.0 % (7 of 7) | 100.0 % (7 of 7) |
1. DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')
GGGTTTGGGT TTTGGGAGGGSolvent system 93% H2O/7% D2O, Pressure 1 (±0.2) atm, Temperature 293.15 (±0.2) K, pH 6.8 (±0.2), Details 1 mM DNA, 93% H2O/7% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
1 | DNA | none | 1 (±1.0) mM | |
2 | H2O | natural abundance | 93 % | |
3 | D2O | natural abundance | 7 % |
Solvent system 100% D2O, Pressure 1 (±0.2) atm, Temperature 293.15 (±0.2) K, pH 6.8 (±0.2), Details 1 mM DNA, 100% D2O
# | Name | Isotope labeling | Type | Concentration |
---|---|---|---|---|
4 | DNA | none | 1 (±1.0) mM | |
5 | D2O | natural abundance | 100 % |