BMRBj - BMREntryMaster

Found 1 Document (0.582 seconds)

BMRB: 30046

5J0M

Ground state sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat

Authors

Borkar, A.N., Bardaro Jr, M., Varani, G., Vendrucolo, M.

Assembly

Cyclic peptide mimetic of HIV-1 Tat/RNA Complex

Entity

1. Cyclic peptide mimetic of HIV-1 Tat (polymer, Thiol state: not present), 14 monomers, 1761.133 Da Detail

RVRTRKGRRI RIXP

2. Apical region (29-mer) of the HIV-1 TAR RNA element (polymer, Thiol state: not present), 29 monomers, 9370.525 Da Detail

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Total weight

11131.658 Da

Max. entity weight

9370.525 Da

Source organism

Human immunodeficiency virus 1

Exptl. method

solution NMR

Refine. method

molecular dynamics

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 30.2 %, Completeness: 15.2 %, Completeness (bb): 6.8 % Detail

Polymer type: polypeptide(L) polyribonucleotide

	Total	¹H	¹³C
All	15.2 % (93 of 610)	26.3 % (93 of 353)	0.0 % (0 of 257)
Backbone	6.8 % (26 of 383)	13.0 % (26 of 200)	0.0 % (0 of 183)
Sidechain	28.0 % (67 of 239)	43.8 % (67 of 153)	0.0 % (0 of 86)
Aromatic	0.0 % (0 of 112)	0.0 % (0 of 64)	0.0 % (0 of 48)
Methyl	42.9 % (6 of 14)	85.7 % (6 of 7)	0.0 % (0 of 7)

1. Cyclic peptide mimetic of HIV-1 Tat

RVRTRKGRRI RIXP

2. Apical region (29-mer) of the HIV-1 TAR RNA element

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 2.0 uM [U-99% 13C; U-99% 15N] Apical region (29-mer) of the HIV-1 TAR RNA element, 2.0 uM [U-99% 13C; U-99% 15N] Cyclic peptide mimetic of HIV-1 Tat, 17 mg/mL Pf1 phage, 100% D2O

#	Name	Isotope labeling	Concentration
1	Apical region (29-mer) of the HIV-1 TAR RNA element	[U-99% 13C; U-99% 15N]	2.0 uM
2	Cyclic peptide mimetic of HIV-1 Tat	[U-99% 13C; U-99% 15N]	2.0 uM
3	Pf1 phage	natural abundance	17 mg/mL
4	D2O	natural abundance	100 %

Chem. Shift Complete2

Sequence coverage: 67.4 %, Completeness: 40.4 %, Completeness (bb): 39.8 % Detail

Polymer type: polypeptide(L) polyribonucleotide

	Total	¹H	¹³C
All	40.4 % (493 of 1220)	46.9 % (331 of 706)	31.5 % (162 of 514)
Backbone	39.8 % (305 of 766)	47.7 % (191 of 400)	31.1 % (114 of 366)
Sidechain	39.3 % (188 of 478)	45.8 % (140 of 306)	27.9 % (48 of 172)
Aromatic	48.2 % (108 of 224)	46.9 % (60 of 128)	50.0 % (48 of 96)
Methyl	21.4 % (6 of 28)	42.9 % (6 of 14)	0.0 % (0 of 14)

1. Cyclic peptide mimetic of HIV-1 Tat

RVRTRKGRRI RIXP

2. Apical region (29-mer) of the HIV-1 TAR RNA element

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Show sample condition

Sample

#	Name	Isotope labeling	Concentration
1	Apical region (29-mer) of the HIV-1 TAR RNA element	[U-99% 13C; U-99% 15N]	2.0 uM
2	Cyclic peptide mimetic of HIV-1 Tat	[U-99% 13C; U-99% 15N]	2.0 uM
3	Pf1 phage	natural abundance	17 mg/mL
4	D2O	natural abundance	100 %

Protein Blocks Logo

Calculated from 10 models in PDB: 5J0M, Strand ID: A Detail

Release date

2016-06-05

Citation

[Microcirculatory changes in diabetes with vascular complications]
Borkar, A.N., Bardaro, M.F., Camilloni, C., Aprile, F.A., Varani, G., Vendrucolo, M.
Harefuah (1981), 100, 250-251, PubMed 7286828 , Abstract

Related entities 1. Cyclic peptide mimetic of HIV-1 Tat, : 1 : 3 : 2 : 1 entities Detail

Experiments performed 1 experiments Detail

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, RDC restraints	combined_30046_5j0m.nef
Input source #2: Coordindates	5j0m.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:12:ILE:C	1:13:DPR:N	unknown	unknown	n/a
1:13:DPR:C	1:14:PRO:N	unknown	unknown	n/a

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
A	13	DPR	D-PROLINE	Assigned chemical shifts, Coordinates

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10----
RVRTRKGRRIRIXP
||||||||||||||
RVRTRKGRRIRIXP

Entity_assembly_ID (NMR): B vs Auth_asym_ID (model): B

--20--------30--------40-----
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
|||||||||||||||||||||||||||||
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
--------10--------20---------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	14	0	0	100.0
B	B	29	0	0	100.0

Content subtype: combined_30046_5j0m.nef

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	2		No information
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	124		100.0 (chain: A, length: 14)
2	Assigned chemical shifts	assigned_chemical_shifts_2	Warning	415		100.0 (chain: B, length: 29)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_2	OK	58 (58)	.	96.6 (chain: B, length: 29)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 14, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 124

Completeness of assignments

Entity_assemble_ID: A

Excluded Comp_ID in statistics

Comp_index_ID	Comp_ID
13	DPR

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	ARG	HH11	6.84
1	ARG	HH12	6.84
1	ARG	HH21	7.18
1	ARG	HH22	7.18
3	ARG	HH11	6.7
3	ARG	HH12	6.7
5	ARG	HH11	7.24
5	ARG	HH12	7.24
5	ARG	HH21	6.74
5	ARG	HH22	6.74
6	LYS	HZ1	7.23
6	LYS	HZ2	7.23
6	LYS	HZ3	7.23
8	ARG	HH11	7.26
8	ARG	HH12	7.26
8	ARG	HH21	7.99
9	ARG	HH11	7.01
9	ARG	HH12	7.01
9	ARG	HH21	6.61
9	ARG	HH22	6.61
11	ARG	HH11	6.85
11	ARG	HH12	6.85
11	ARG	HH21	6.47
11	ARG	HH22	6.47

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	97	93	95.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	26	26	100.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	71	67	94.4

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	7	6	85.7

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Histogram of normalized assigned chemical shifts
Random coil index and derived parameters (S² and NMR RMSD)
- Chain_ID: A

Saveframe: assigned_chemical_shifts_2
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 29, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 253
  - ¹³C chemical shifts: 162
- Completeness of assignments
  - Entity_assemble_ID: B
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
18	G	H21	8.51
18	G	H22	6.13
20	A	H61	7.78
20	A	H62	6.36
21	G	H21	8.01
22	A	H61	8.43
22	A	H62	7.16
26	G	H21	8.21
26	G	H22	5.96
27	A	H61	8.04
27	A	H62	8.07
28	G	H21	6.57
36	G	H21	6.4
43	G	H21	8.3
43	G	H22	6.15

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	256	238	93.0
¹³C chemical shifts	193	162	83.9

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	165	94.8
¹³C chemical shifts	145	114	78.6

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	82	73	89.0
¹³C chemical shifts	48	48	100.0

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	18	18	100.0
¹³C chemical shifts	18	18	100.0

Covalent bonds

Saveframe: assembly
- Status: OK

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 29, Sequence coverage: 96.6%
- Total number of restraints: 58
- Potential type of restraints: undefined (58)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: B
    None

Keywords RAM simulations, Residual dipolar couplings, TAR:Tat complex, ground state, viral protein

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.582 seconds)

BMRB: 30046

Sample

Sample

Related entities 1. Cyclic peptide mimetic of HIV-1 Tat, : 1 : 3 : 2 : 1 entities Detail

Experiments performed 1 experiments Detail

Instrument

Sample

NMR combined restraints 4 contents Detail