BMRBj - BMREntryMaster

Found 1 Document (0.607 seconds)

BMRB: 30049

5J1O

Excited state (Bound-like) sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat

Authors

Borkar, A.N., Bardaro, M.F., Varani, G., Vendrucolo, M.

Assembly

Cyclic peptide mimetic of Tat/RNA Complex

Entity

1. Cyclic peptide mimetic of Tat (polymer, Thiol state: not present), 14 monomers, 1761.133 Da Detail

RVRTRKGRRI RIXP

2. Apical region (29mer) of the HIV-1 TAR RNA element (polymer), 29 monomers, 9370.525 Da Detail

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Total weight

11131.658 Da

Max. entity weight

9370.525 Da

Source organism

Human immunodeficiency virus 1

Exptl. method

solution NMR

Refine. method

molecular dynamics

Data set

assigned_chemical_shifts

Chem. Shift Complete1

Sequence coverage: 30.2 %, Completeness: 17.0 %, Completeness (bb): 8.1 % Detail

Polymer type: polypeptide(L) polyribonucleotide

	Total	¹H	¹³C
All	17.0 % (104 of 610)	26.6 % (94 of 353)	3.9 % (10 of 257)
Backbone	8.1 % (31 of 383)	13.0 % (26 of 200)	2.7 % (5 of 183)
Sidechain	31.4 % (75 of 239)	44.4 % (68 of 153)	8.1 % (7 of 86)
Aromatic	0.0 % (0 of 112)	0.0 % (0 of 64)	0.0 % (0 of 48)
Methyl	42.9 % (6 of 14)	85.7 % (6 of 7)	0.0 % (0 of 7)

1. Cyclic peptide mimetic of Tat

RVRTRKGRRI RIXP

2. Apical region (29mer) of the HIV-1 TAR RNA element

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 2 uM [U-99% 13C; U-99% 15N] RNA and peptide, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA and peptide	[U-99% 13C; U-99% 15N]		2 uM
2	D2O	natural abundance		100 %

Chem. Shift Complete2

Sequence coverage: 67.4 %, Completeness: 41.3 %, Completeness (bb): 40.5 % Detail

Polymer type: polypeptide(L) polyribonucleotide

	Total	¹H	¹³C
All	41.3 % (504 of 1220)	47.0 % (332 of 706)	33.5 % (172 of 514)
Backbone	40.5 % (310 of 766)	47.7 % (191 of 400)	32.5 % (119 of 366)
Sidechain	41.0 % (196 of 478)	46.1 % (141 of 306)	32.0 % (55 of 172)
Aromatic	48.2 % (108 of 224)	46.9 % (60 of 128)	50.0 % (48 of 96)
Methyl	21.4 % (6 of 28)	42.9 % (6 of 14)	0.0 % (0 of 14)

1. Cyclic peptide mimetic of Tat

RVRTRKGRRI RIXP

2. Apical region (29mer) of the HIV-1 TAR RNA element

GGCAGAUCUG AGCCUGGGAG CUCUCUGCC

Show sample condition

Sample

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.6, Details 2 uM [U-99% 13C; U-99% 15N] RNA and peptide, 100% D2O

#	Name	Isotope labeling	Type	Concentration
1	RNA and peptide	[U-99% 13C; U-99% 15N]		2 uM
2	D2O	natural abundance		100 %

Protein Blocks Logo

Calculated from 10 models in PDB: 5J1O, Strand ID: A Detail

Release date

2016-06-05

Citation

[Microcirculatory changes in diabetes with vascular complications]
Borkar, A.N., Bardaro, M.F., Camilloni, C., Aprile, F.A., Varani, G., Vendrucolo, M.
Harefuah (1981), 100, 250-251, PubMed 7286828 , DOI: , Abstract

Entries sharing articles BMRB: 2 entries Detail

  BMRB: 30046 released on 2016-06-05
    Title Ground state sampled during RDC restrained Replica-averaged Metadynamics (RAM) simulations of the HIV-1 TAR complexed with cyclic peptide mimetic of Tat
  BMRB: 30051 released on 2016-06-05
    Title Intermediate state lying on the pathway of release of Tat from HIV-1 TAR.

Related entities 1. Cyclic peptide mimetic of Tat, : 1 : 3 : 2 : 1 entities Detail

Experiments performed 1 experiments Detail

NMR combined restraints 4 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, RDC restraints	combined_30049_5j1o.nef
Input source #2: Coordindates	5j1o.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	True (see coodinates for details)
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Ptnr_site_1	Ptnr_site_2	Redox_state_prediction_1	Redox_state_prediction_2	Distance (Å)
1:12:ILE:C	1:13:DPR:N	unknown	unknown	n/a
1:13:DPR:C	1:14:PRO:N	unknown	unknown	n/a

Non-standard residues

Chain_ID	Seq_ID	Comp_ID	Chem_comp_name	Experimental evidences
A	13	DPR	D-PROLINE	Assigned chemical shifts, Coordinates

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10----
RVRTRKGRRIRIXP
||||||||||||||
RVRTRKGRRIRIXP

Entity_assembly_ID (NMR): B vs Auth_asym_ID (model): B

--20--------30--------40-----
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
|||||||||||||||||||||||||||||
GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
--------10--------20---------

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	14	0	0	100.0
B	B	29	0	0	100.0

Content subtype: combined_30049_5j1o.nef

#	Content subtype	Saveframe	Status	# of rows	Experiment type	Sequence coverage (%)
1	Covalent bonds	assembly	OK	2		No information
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	124		100.0 (chain: A, length: 14)
2	Assigned chemical shifts	assigned_chemical_shifts_2	Warning	335		79.3 (chain: B, length: 29)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_2	OK	58 (58)	.	96.6 (chain: B, length: 29)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 14, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 124

Completeness of assignments

Entity_assemble_ID: A

Excluded Comp_ID in statistics

Comp_index_ID	Comp_ID
13	DPR

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	ARG	HH11	6.84
1	ARG	HH12	6.84
1	ARG	HH21	7.18
1	ARG	HH22	7.18
3	ARG	HH11	6.7
3	ARG	HH12	6.7
5	ARG	HH11	7.24
5	ARG	HH12	7.24
5	ARG	HH21	6.74
5	ARG	HH22	6.74
6	LYS	HZ1	7.23
6	LYS	HZ2	7.23
6	LYS	HZ3	7.23
8	ARG	HH11	7.26
8	ARG	HH12	7.26
8	ARG	HH21	7.99
9	ARG	HH11	7.01
9	ARG	HH12	7.01
9	ARG	HH21	6.61
9	ARG	HH22	6.61
11	ARG	HH11	6.85
11	ARG	HH12	6.85
11	ARG	HH21	6.47
11	ARG	HH22	6.47

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	97	93	95.9

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	26	26	100.0

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	71	67	94.4

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	7	6	85.7

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Histogram of normalized assigned chemical shifts
Random coil index and derived parameters (S² and NMR RMSD)
- Chain_ID: A

Saveframe: assigned_chemical_shifts_2
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 29, Sequence coverage: 79.3%
- Total number of assignments
  - ¹H chemical shifts: 202
  - ¹³C chemical shifts: 133
- Completeness of assignments
  - Entity_assemble_ID: B
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
18	G	H21	8.51
18	G	H22	6.13
20	A	H61	7.78
20	A	H62	6.36
21	G	H21	8.01
26	G	H21	8.21
26	G	H22	5.96
27	A	H61	8.04
27	A	H62	8.07
34	G	H21	6.4
43	G	H21	8.3
43	G	H22	6.15

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	256	190	74.2
¹³C chemical shifts	193	133	68.9

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	174	130	74.7
¹³C chemical shifts	145	95	65.5

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	82	60	73.2
¹³C chemical shifts	48	38	79.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	18	14	77.8
¹³C chemical shifts	18	14	77.8

Covalent bonds

Saveframe: assembly
- Status: OK

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: B, Chain length: 29, Sequence coverage: 96.6%
- Total number of restraints: 58
- Potential type of restraints: undefined (58)
- Range of observed RDC values: 100.0, -100.0 (Hz)
- RDC restraints per residue
  - Chain_ID: B
    None

Keywords RAM simulations, Residual dipolar couplings, TAR:Tat complex, excited state, viral protein

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.607 seconds)

BMRB: 30049

Sample

Sample

Entries sharing articles BMRB: 2 entries Detail

Related entities 1. Cyclic peptide mimetic of Tat, : 1 : 3 : 2 : 1 entities Detail

Experiments performed 1 experiments Detail

Instrument

Sample

NMR combined restraints 4 contents Detail