Properties

Disulfide bonds

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

Non-standard residues

Sequence alignments

• Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20-----
GGGGTTTGGGGTTTTGGGGAAGGGG
|||||||||||||||||||||||||
GGGGTTTGGGGTTTTGGGGAAGGGG

Chain assignments

Content subtype: combined_30058_5j6u.nef

Assigned chemical shifts

1. Saveframe: assigned_chemical_shifts_1
   • Status: Warning
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 25, Sequence coverage: 100.0%

     --------10--------20-----
     GGGGTTTGGGGTTTTGGGGAAGGGG
     |||||||||||||||||||||||||
     GGGGTTTGGGGTTTTGGGGAAGGGG
     

   • Total number of assignments
     • ¹H chemical shifts: 242
   • Completeness of assignments
     • Entity_assemble_ID: A
       • Excluded Atom_ID in statistics

         Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
         1	DG	H22	10.19
         1	DG	H21	5.82
         2	DG	H22	9.25
         2	DG	H21	6.03
         3	DG	H21	8.92
         4	DG	H22	9.69
         4	DG	H21	6.16
         8	DG	H22	9.46
         8	DG	H21	5.86
         9	DG	H22	9.69
         9	DG	H21	6.08
         10	DG	H22	8.74
         10	DG	H21	6.03
         16	DG	H22	9.32
         16	DG	H21	7.22
         17	DG	H22	9.39
         17	DG	H21	6.02
         18	DG	H22	8.43
         18	DG	H21	5.97
         22	DG	H22	9.34
         22	DG	H21	6.63
         24	DG	H22	8.61
         24	DG	H21	6.17
         25	DG	H22	8.73
         25	DG	H21	6.04

       • All atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	232	217	93.5

       • Backbone atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	175	168	96.0

       • Side chain atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	57	49	86.0

       • Methyl group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	7	7	100.0

       • Aromatic group atoms

         Atom group	# of target shifts	# of assigned shifts	Completeness (%)
         1H chemical shifts	20	20	100.0

   • Histogram of normalized assigned chemical shifts

Distance restraints

1. Saveframe: CNS/XPLOR_distance_constraints_2
   • Status: Warning
   • Experiment type: noe
   • Sequence coverage of experimental data
     • Entity_assembly_ID: A, Chain length: 25, Sequence coverage: 100.0%

     --------10--------20-----
     GGGGTTTGGGGTTTTGGGGAAGGGG
     |||||||||||||||||||||||||
     GGGGTTTGGGGTTTTGGGGAAGGGG
     

   • Total number of restraints: 1032
     • Intra-residue restraints, i = j : 654
     • Sequential restraints, | i - j | = 1 : 314
       • Backbone-backbone: 117
       • Backbone-side chain: 174
       • Side chain-side chain: 23
     • Medium range restraints, 1 < | i - j | < 5 : 14
       • Backbone-side chain: 6
       • Side chain-side chain: 8
     • Long range restraints, | i - j | >= 5 : 50
   • Weight of restraints: 1.0 (1032)
     • Intra-residue restraints, i = j : 1.0 (654)
     • Sequential restraints, | i - j | = 1 : 1.0 (314)
       • Backbone-backbone: 1.0 (117)
       • Backbone-side chain: 1.0 (174)
       • Side chain-side chain: 1.0 (23)
     • Medium range restraints, 1 < | i - j | < 5 : 1.0 (14)
       • Backbone-side chain: 1.0 (6)
       • Side chain-side chain: 1.0 (8)
     • Long range restraints, | i - j | >= 5 : 1.0 (50)
   • Potential type of restraints: square-well-parabolic (1032)
     • Intra-residue restraints, i = j : square-well-parabolic (654)
     • Sequential restraints, | i - j | = 1 : square-well-parabolic (314)
       • Backbone-backbone: square-well-parabolic (117)
       • Backbone-side chain: square-well-parabolic (174)
       • Side chain-side chain: square-well-parabolic (23)
     • Medium range restraints, 1 < | i - j | < 5 : square-well-parabolic (14)
       • Backbone-side chain: square-well-parabolic (6)
       • Side chain-side chain: square-well-parabolic (8)
     • Long range restraints, | i - j | >= 5 : square-well-parabolic (50)
   • Range of distance target values: 2.21, 5.5 (Å)
   • Histogram of distance target values
   • Histogram of discrepancy in distance target values
   • Distance restraints per residue
     • Chain_ID: A
   • Distance restraints on contact map
     • Chain_ID_1: A - Chain_ID_2: A