BMRBj - BMREntryMaster

Found 1 Document (0.418 seconds)

BMRB: 30108

5KH8

Solution structures of the apo state fluoride riboswitch

Authors

Zhang, Q., Zhao, B.

Assembly

riboswitch (47-MER)

Entity

1. riboswitch (47-MER) (polymer, Thiol state: not present), 47 monomers, 15116.93 Da Detail

GGCGAUGGUG UUCGCCAUAA ACGCUCUUCG GAGCUAAUGA CACCUAC

Formula weight

15116.93 Da

Source organism

synthetic construct

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 72.8 %, Completeness (bb): 66.9 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	72.8 % (548 of 753)	70.0 % (289 of 413)	75.7 % (240 of 317)	82.6 % (19 of 23)
Suger, PO4	66.9 % (346 of 517)	66.7 % (188 of 282)	67.2 % (158 of 235)
Nucleobase	85.6 % (202 of 236)	77.1 % (101 of 131)	100.0 % (82 of 82)	82.6 % (19 of 23)
Aromatic	96.2 % (202 of 210)	96.2 % (101 of 105)	100.0 % (82 of 82)	82.6 % (19 of 23)

1. riboswitch (47-MER)

GGCGAUGGUG UUCGCCAUAA ACGCUCUUCG GAGCUAAUGA CACCUAC

Show sample condition

Sample #1

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	50 uM
2	RNA (47mer)	natural abundance	1.0 mM
3	magnesium chloride	natural abundance	10 mM
4	potassium chloride	natural abundance	50 mM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	95 %
7	D2O	natural abundance	5 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
8	EDTA	natural abundance	50 uM
9	RNA (47mer)	natural abundance	1.0 mM
10	magnesium chloride	natural abundance	10 mM
11	potassium chloride	natural abundance	50 mM
12	sodium phosphate	natural abundance	10 mM
13	D2O	natural abundance	100 %

Sample #3

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-100% 13C; U-100% 15N] RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
14	EDTA	natural abundance	50 uM
15	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
16	magnesium chloride	natural abundance	10 mM
17	potassium chloride	natural abundance	50 mM
18	sodium phosphate	natural abundance	10 mM
19	H2O	natural abundance	95 %
20	D2O	natural abundance	5 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-100% 13C; U-100% 15N] RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
21	EDTA	natural abundance	50 uM
22	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
23	magnesium chloride	natural abundance	10 mM
24	potassium chloride	natural abundance	50 mM
25	sodium phosphate	natural abundance	10 mM
26	D2O	natural abundance	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-13C; U-15N]-Gua RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

Release date

2016-11-10

Citation

An excited state underlies gene regulation of a transcriptional riboswitch
Zhao, B., Guffy, S.L., Williams, B., Zhang, Q.
Nat. Chem. Biol. (2017), 13, 968-974, PubMed 28719589 , DOI 10.1038/nchembio.2427 , Abstract

Experiments performed 18 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 1.0 mM RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	50 uM
2	RNA (47mer)	natural abundance	1.0 mM
3	magnesium chloride	natural abundance	10 mM
4	potassium chloride	natural abundance	50 mM
5	sodium phosphate	natural abundance	10 mM
6	H2O	natural abundance	95 %
7	D2O	natural abundance	5 %

2 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
8	EDTA	natural abundance	50 uM
9	RNA (47mer)	natural abundance	1.0 mM
10	magnesium chloride	natural abundance	10 mM
11	potassium chloride	natural abundance	50 mM
12	sodium phosphate	natural abundance	10 mM
13	D2O	natural abundance	100 %

3 2D 1H-1H TOCSY

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
8	EDTA	natural abundance	50 uM
9	RNA (47mer)	natural abundance	1.0 mM
10	magnesium chloride	natural abundance	10 mM
11	potassium chloride	natural abundance	50 mM
12	sodium phosphate	natural abundance	10 mM
13	D2O	natural abundance	100 %

4 2D 1H-15N HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 1.0 mM [U-100% 13C; U-100% 15N] RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
14	EDTA	natural abundance	50 uM
15	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
16	magnesium chloride	natural abundance	10 mM
17	potassium chloride	natural abundance	50 mM
18	sodium phosphate	natural abundance	10 mM
19	H2O	natural abundance	95 %
20	D2O	natural abundance	5 %

5 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
14	EDTA	natural abundance	50 uM
15	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
16	magnesium chloride	natural abundance	10 mM
17	potassium chloride	natural abundance	50 mM
18	sodium phosphate	natural abundance	10 mM
19	H2O	natural abundance	95 %
20	D2O	natural abundance	5 %

6 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-13C; U-15N]-Gua RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

7 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-100% 13C; U-100% 15N] RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
21	EDTA	natural abundance	50 uM
22	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
23	magnesium chloride	natural abundance	10 mM
24	potassium chloride	natural abundance	50 mM
25	sodium phosphate	natural abundance	10 mM
26	D2O	natural abundance	100 %

8 2D HCCH COSY

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

9 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

10 2D HCCH COSY

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

11 31P spin-echo

Instrument

Bruker AvanceIII - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

12 31P spin-echo

Instrument

Bruker AvanceIII - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

13 3D HCCH-TOCSY

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

14 3D HCCH-TOCSY

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

15 2D 1H-13C HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

State anisotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 303 K, pH 6.4, Details 1.0 mM [U-100% 13C; U-100% 15N] RNA (47mer), 10 mM magnesium chloride, 10 mM sodium phosphate, 50 mM potassium chloride, 50 uM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
14	EDTA	natural abundance	50 uM
15	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
16	magnesium chloride	natural abundance	10 mM
17	potassium chloride	natural abundance	50 mM
18	sodium phosphate	natural abundance	10 mM
19	H2O	natural abundance	95 %
20	D2O	natural abundance	5 %

16 CH-HCCH spin-echo

Instrument

Bruker AvanceIII - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	50 uM
28	RNA (47mer)	[U-13C; U-15N]-Gua	1.0 mM
29	magnesium chloride	natural abundance	10 mM
30	potassium chloride	natural abundance	50 mM
31	sodium phosphate	natural abundance	10 mM
32	D2O	natural abundance	100 %

17 2D 1H-15N HSQC

Instrument

Bruker AvanceIII - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
14	EDTA	natural abundance	50 uM
15	RNA (47mer)	[U-100% 13C; U-100% 15N]	1.0 mM
16	magnesium chloride	natural abundance	10 mM
17	potassium chloride	natural abundance	50 mM
18	sodium phosphate	natural abundance	10 mM
19	H2O	natural abundance	95 %
20	D2O	natural abundance	5 %

18 CH-HCCH spin-echo

Instrument

Bruker AvanceIII - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
33	EDTA	natural abundance	50 uM
34	RNA (47mer)	[U-13C; U-15N]-Ade ;[U-13C; U-15N]-Ura	1.0 mM
35	magnesium chloride	natural abundance	10 mM
36	potassium chloride	natural abundance	50 mM
37	sodium phosphate	natural abundance	10 mM
38	D2O	natural abundance	100 %

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_30108_5kh8.nef
Input source #2: Coordindates	5kh8.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30--------40-------
GGCGAUGGUGUUCGCCAUAAACGCUCUUCGGAGCUAAUGACACCUAC
|||||||||||||||||||||||||||||||||||||||||||||||
GGCGAUGGUGUUCGCCAUAAACGCUCUUCGGAGCUAAUGACACCUAC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	47	0	0	100.0

Content subtype: combined_30108_5kh8.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	549		100.0 (chain: A, length: 47)
1	Distance restraints	CNS/XPLOR_distance_constraints_4	Warning	900 (1)	noe	100.0 (chain: A, length: 47)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	260 (260)	.	100.0 (chain: A, length: 47)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_2	OK	77 (77)	.	72.3 (chain: A, length: 47)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1
- Status: Warning
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 47, Sequence coverage: 100.0%
- Total number of assignments
  - ¹H chemical shifts: 290
  - ¹³C chemical shifts: 240
  - ¹⁵N chemical shifts: 19
- Completeness of assignments
  - Entity_assemble_ID: A
- Histogram of normalized assigned chemical shifts

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
38	U	HO2'	8.743

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	413	289	70.0
¹³C chemical shifts	317	240	75.7
¹⁵N chemical shifts	23	19	82.6

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	282	188	66.7
¹³C chemical shifts	235	158	67.2

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	131	101	77.1
¹³C chemical shifts	82	82	100.0
¹⁵N chemical shifts	23	19	82.6

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	34	34	100.0
¹³C chemical shifts	34	34	100.0

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_4
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 47, Sequence coverage: 100.0%
- Total number of restraints: 900
- Weight of restraints: 1.0 (900)
- Potential type of restraints: square-well-parabolic (900)
- Range of distance target values: 2.0, 5.5 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 47, Sequence coverage: 100.0%
- Total number of restraints: 260
- Total number of restraints per polymer type: 260
- Weight of restraints: 1.0 (260)
- Potential type of restraints: square-well-parabolic (260)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_2
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 47, Sequence coverage: 72.3%
- Total number of restraints: 77
- Potential type of restraints: square-well-parabolic (77)
- Range of observed RDC values: -39.23, 44.93 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords RNA, apo state, pseudoknot, riboswitch aptamer, transcriptional regulation

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.418 seconds)

BMRB: 30108

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Experiments performed 18 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail