BMRBj - BMREntryMaster

Found 1 Document (0.388 seconds)

BMRB: 30132

5KQE

Solution structure of P2a-J2a/b-P2b of medaka telomerase RNA

Authors

Wang, Y., Feigon, J.

Assembly

Telomerase RNA P2ab

Entity

1. Telomerase RNA P2ab (polymer, Thiol state: not present), 36 monomers, 11527.77 Da Detail

GGGUGUACUU AACGUUUGCU UCGGCAAACU ACAUCC

Formula weight

11527.77 Da

Source organism

Oryzias latipes

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 82.4 %, Completeness (bb): 77.5 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N
All	82.4 % (478 of 580)	81.4 % (258 of 317)	84.4 % (206 of 244)	73.7 % (14 of 19)
Suger, PO4	77.5 % (307 of 396)	76.4 % (165 of 216)	78.9 % (142 of 180)
Nucleobase	92.9 % (171 of 184)	92.1 % (93 of 101)	100.0 % (64 of 64)	73.7 % (14 of 19)
Aromatic	94.6 % (157 of 166)	95.2 % (79 of 83)	100.0 % (64 of 64)	73.7 % (14 of 19)

1. entity 1

GGGUGUACUU AACGUUUGCU UCGGCAAACU ACAUCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM [U-13C; U-15N] Telomerase RNA P2ab, 100% D2O

#	Name	Isotope labeling	Concentration
1	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
2	potassium chloride	natural abundance	100 mM
3	sodium phosphate	natural abundance	10 mM

Sample #2

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM Telomerase RNA P2ab, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
4	Telomerase RNA P2ab	natural abundance	1.0 mM
5	potassium chloride	natural abundance	100 mM
6	sodium phosphate	natural abundance	10 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM Telomerase RNA P2ab, 100% D2O

#	Name	Isotope labeling	Concentration
7	Telomerase RNA P2ab	natural abundance	1.0 mM
8	potassium chloride	natural abundance	100 mM
9	sodium phosphate	natural abundance	10 mM

Sample #4

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM [U-13C; U-15N] Telomerase RNA P2ab, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
10	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
11	potassium chloride	natural abundance	100 mM
12	sodium phosphate	natural abundance	10 mM

Release date

2016-08-21

Citation

Structural conservation in the template/pseudoknot domain of vertebrate telomerase RNA from teleost fish to human
Wang, Y., Yesselman, J.D., Zhang, Q., Kang, M., Feigon, J.
Proc. Natl. Acad. Sci. U. S. A. (2016), 113, E5125-E5134, PubMed 27531956 , DOI 10.1073/pnas.1607411113 , Abstract

Related entities 1. Telomerase RNA P2ab, : 1 entities Detail

Experiments performed 10 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM Telomerase RNA P2ab, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
4	Telomerase RNA P2ab	natural abundance	1.0 mM
5	potassium chloride	natural abundance	100 mM
6	sodium phosphate	natural abundance	10 mM

2 2D 1H-1H TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
4	Telomerase RNA P2ab	natural abundance	1.0 mM
5	potassium chloride	natural abundance	100 mM
6	sodium phosphate	natural abundance	10 mM

3 2D 1H-1H NOESY

Instrument

Bruker Avance - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM Telomerase RNA P2ab, 100% D2O

#	Name	Isotope labeling	Concentration
7	Telomerase RNA P2ab	natural abundance	1.0 mM
8	potassium chloride	natural abundance	100 mM
9	sodium phosphate	natural abundance	10 mM

4 2D 1H-1H TOCSY

Instrument

Bruker Avance - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
7	Telomerase RNA P2ab	natural abundance	1.0 mM
8	potassium chloride	natural abundance	100 mM
9	sodium phosphate	natural abundance	10 mM

5 2D 1H-15N HSQC

Instrument

Bruker DRX - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
10	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
11	potassium chloride	natural abundance	100 mM
12	sodium phosphate	natural abundance	10 mM

6 2D 1H-13C HSQC

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM [U-13C; U-15N] Telomerase RNA P2ab, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
10	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
11	potassium chloride	natural abundance	100 mM
12	sodium phosphate	natural abundance	10 mM

7 3D HCCH-TOCSY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 283 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM [U-13C; U-15N] Telomerase RNA P2ab, 100% D2O

#	Name	Isotope labeling	Concentration
1	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
2	potassium chloride	natural abundance	100 mM
3	sodium phosphate	natural abundance	10 mM

8 2D filtered/edited NOESY

Instrument

Bruker DRX - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.4, Details 10 mM sodium phosphate, 100 mM potassium chloride, 1.0 mM [U-13C; U-15N] Telomerase RNA P2ab, 100% D2O

#	Name	Isotope labeling	Concentration
1	Telomerase RNA P2ab	[U-13C; U-15N]	1.0 mM
2	potassium chloride	natural abundance	100 mM
3	sodium phosphate	natural abundance	10 mM

9 2D DQF-COSY

Instrument

Bruker DMX - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
4	Telomerase RNA P2ab	natural abundance	1.0 mM
5	potassium chloride	natural abundance	100 mM
6	sodium phosphate	natural abundance	10 mM

10 JNN-COSY

Instrument

Bruker DRX - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
4	Telomerase RNA P2ab	natural abundance	1.0 mM
5	potassium chloride	natural abundance	100 mM
6	sodium phosphate	natural abundance	10 mM

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_30132_5kqe.nef
Input source #2: Coordindates	5kqe.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20--------30------
GGGUGUACUUAACGUUUGCUUCGGCAAACUACAUCC
||||||||||||||||||||||||||||||||||||
GGGUGUACUUAACGUUUGCUUCGGCAAACUACAUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	36	0	0	100.0

Content subtype: combined_30132_5kqe.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	515		100.0 (chain: A, length: 36)
1	Distance restraints	CNS/XPLOR_distance_constraints_2	Warning	804 (1)	noe	100.0 (chain: A, length: 36)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	240 (240)	.	100.0 (chain: A, length: 36)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_4	OK	81 (81)	.	86.1 (chain: A, length: 36)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%

--------10--------20--------30------
GGGUGUACUUAACGUUUGCUUCGGCAAACUACAUCC
||||||||||||||||||||||||||||||||||||
GGGUGUACUUAACGUUUGCUUCGGCAAACUACAUCC

Total number of assignments
- ¹H chemical shifts: 272
- ¹³C chemical shifts: 206
- ¹⁵N chemical shifts: 37

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	H21	6.988
1	G	H22	8.619
3	G	H21	6.482
5	G	H21	6.136
5	G	H22	8.069
7	A	N1	219.222
7	A	N3	209.376
11	A	N1	211.578
12	A	N1	219.293
12	A	N3	210.194
18	G	H21	6.454
18	G	H22	5.93
20	U	HO2'	6.686
24	G	H21	6.459
24	G	H22	8.777
25	C	N4	92.203
26	A	N1	215.21
26	A	N3	207.977
26	A	N6	78.137
27	A	N1	215.207
27	A	N3	206.244
27	A	N6	79.26
28	A	H61	6.813
28	A	H62	8.209
28	A	N1	216.552
28	A	N3	206.5
29	C	N4	93.049
31	A	N1	217.297
31	A	N3	208.244
32	C	N4	91.882
33	A	H61	6.551
33	A	H62	8.344
33	A	N1	216.44
33	A	N3	209.686
33	A	N6	77.862
35	C	N4	92.936
36	C	N4	92.241

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	317	258	81.4
¹³C chemical shifts	244	206	84.4
¹⁵N chemical shifts	19	14	73.7

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	216	165	76.4
¹³C chemical shifts	180	142	78.9

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	101	93	92.1
¹³C chemical shifts	64	64	100.0
¹⁵N chemical shifts	19	14	73.7

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	24	24	100.0
¹³C chemical shifts	24	24	100.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_2
- Status: Warning
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Total number of restraints: 804
- Weight of restraints: 1.0 (804)
- Potential type of restraints: square-well-parabolic (804)
- Range of distance target values: 2.65, 4.65 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 100.0%
- Total number of restraints: 240
- Total number of restraints per polymer type: 240
- Weight of restraints: 1.0 (240)
- Potential type of restraints: square-well-parabolic (240)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_4
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 36, Sequence coverage: 86.1%
- Total number of restraints: 81
- Potential type of restraints: square-well-parabolic (81)
- Range of observed RDC values: -39.78, 40.36 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords RNA, Telomerase RNA TR Medaka P2ab

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.388 seconds)

BMRB: 30132

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. Telomerase RNA P2ab, : 1 entities Detail

Experiments performed 10 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail