BMRBj - BMREntryMaster

Found 1 Document (0.549 seconds)

BMRB: 30224

5UF3

Structure Effects of the Four-Adenine Loop of the Coliphage GA Replicase RNA Operator

Authors

Chang, A.T., Tran, M., DeJong, E., Nikonowicz, E.P.

Assembly

phage GA operator RNA hairpin

Entity

1. phage GA operator RNA hairpin (polymer, Thiol state: not present), 23 monomers, 7457.467 Da Detail

GGACAUAAGG AAAACCUAUG UCC

Formula weight

7457.467 Da

Source organism

Enterobacteria phage GA

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 93.0 %, Completeness (bb): 93.5 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C	¹⁵N	³¹P
All	93.0 % (359 of 386)	94.9 % (188 of 198)	91.7 % (143 of 156)	77.8 % (7 of 9)	91.3 % (21 of 23)
Suger, PO4	93.5 % (258 of 276)	95.7 % (132 of 138)	91.3 % (105 of 115)		91.3 % (21 of 23)
Nucleobase	91.8 % (101 of 110)	93.3 % (56 of 60)	92.7 % (38 of 41)	77.8 % (7 of 9)
Aromatic	93.0 % (93 of 100)	96.0 % (48 of 50)	92.7 % (38 of 41)	77.8 % (7 of 9)

1. phage GA operator RNA hairpin

GGACAUAAGG AAAACCUAUG UCC

Show sample condition

Sample #1

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium phosphate, 10 mM potassium chloride, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.5 mM phage GA operator RNA hairpin, 10 mM potassium phosphate, 10 mM potassium chloride, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
6	EDTA	natural abundance	0.02 mM
7	phage GA operator RNA hairpin	natural abundance	1.5 (±0.1) mM
8	potassium chloride	natural abundance	10 mM
9	potassium phosphate	natural abundance	10 mM
10	D2O	natural abundance	100 %

Sample #3

Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM EDTA, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
11	EDTA	natural abundance	0.02 mM
12	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
13	potassium chloride	natural abundance	10 mM
14	potassium phosphate	natural abundance	10 mM
15	H2O	natural abundance	90 %
16	D2O	natural abundance	10 %

Sample #4

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 0.3 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 15 mg/mL Pf1 phage, 100% D2O

#	Name	Isotope labeling	Concentration
17	Pf1 phage	natural abundance	15 mg/mL
18	phage GA operator RNA hairpin	[U-13C; U-15N]	0.3 (±0.01) mM
19	potassium chloride	natural abundance	10 mM
20	potassium phosphate	natural abundance	10 mM
21	D2O	natural abundance	100 %

Sample #5

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.2 mM 2H, 40%-85% phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
22	EDTA	natural abundance	0.02 mM
23	phage GA operator RNA hairpin	2H, 40%-85%	1.2 mM
24	potassium chloride	natural abundance	10 mM
25	potassium phosphate	natural abundance	10 mM
26	D2O	natural abundance	100 %

Sample #6

Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.1 mM 13C, 4%-20% phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM na EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	0.02 mM
28	phage GA operator RNA hairpin	13C, 4%-20%	1.1 mM
29	potassium chloride	natural abundance	10 mM
30	potassium phosphate	natural abundance	10 mM
31	D2O	natural abundance	100 %

Release date

2017-02-01

Citation

Structure and Dynamics of the Tetra-A Loop and (A-A)-U Sequence Motif within the Coliphage GA Replicase RNA Operator
Chang, A.T., Tran, M., Nikonowicz, E.P.
Biochemistry (2017), 56, 2690-2700, PubMed 28488852 , DOI 10.1021/acs.biochem.7b00123 , Abstract

Experiments performed 14 experiments Detail

1 2D 1H-1H NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.5 mM phage GA operator RNA hairpin, 10 mM potassium phosphate, 10 mM potassium chloride, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
6	EDTA	natural abundance	0.02 mM
7	phage GA operator RNA hairpin	natural abundance	1.5 (±0.1) mM
8	potassium chloride	natural abundance	10 mM
9	potassium phosphate	natural abundance	10 mM
10	D2O	natural abundance	100 %

2 3D 1H-13C NOESY

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium phosphate, 10 mM potassium chloride, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

3 2D 1H-13C HSQC

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

4 3D HCCH-TOCSY

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

5 2D 1H-15N HSQC

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 90% H2O/10% D2O, Pressure 1 atm, Temperature 285 K, pH 6.8, Details 1 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM EDTA, 90% H2O/10% D2O

#	Name	Isotope labeling	Concentration
11	EDTA	natural abundance	0.02 mM
12	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
13	potassium chloride	natural abundance	10 mM
14	potassium phosphate	natural abundance	10 mM
15	H2O	natural abundance	90 %
16	D2O	natural abundance	10 %

6 2D 1H-31P HetCor

Instrument

Varian INOVA - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.2 mM 2H, 40%-85% phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
22	EDTA	natural abundance	0.02 mM
23	phage GA operator RNA hairpin	2H, 40%-85%	1.2 mM
24	potassium chloride	natural abundance	10 mM
25	potassium phosphate	natural abundance	10 mM
26	D2O	natural abundance	100 %

7 2D 1H-13C CTEP

Instrument

Varian INOVA - 500 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

8 2D 1H-13C HSQC

Instrument

Varian INOVA - 600 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 1.1 mM 13C, 4%-20% phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 0.02 mM na EDTA, 100% D2O

#	Name	Isotope labeling	Concentration
27	EDTA	natural abundance	0.02 mM
28	phage GA operator RNA hairpin	13C, 4%-20%	1.1 mM
29	potassium chloride	natural abundance	10 mM
30	potassium phosphate	natural abundance	10 mM
31	D2O	natural abundance	100 %

9 2D 1H-13C HSQC

Instrument

Varian INOVA - 600 MHz

Sample

State anisotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 298 K, pH 6.8, Details 0.3 mM [U-13C; U-15N] phage GA operator RNA hairpin, 10 mM potassium chloride, 10 mM potassium phosphate, 15 mg/mL Pf1 phage, 100% D2O

#	Name	Isotope labeling	Concentration
17	Pf1 phage	natural abundance	15 mg/mL
18	phage GA operator RNA hairpin	[U-13C; U-15N]	0.3 (±0.01) mM
19	potassium chloride	natural abundance	10 mM
20	potassium phosphate	natural abundance	10 mM
21	D2O	natural abundance	100 %

10 3D 1H-15N NOESY

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
11	EDTA	natural abundance	0.02 mM
12	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
13	potassium chloride	natural abundance	10 mM
14	potassium phosphate	natural abundance	10 mM
15	H2O	natural abundance	90 %
16	D2O	natural abundance	10 %

11 2D 1H-13C H(N)CO

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

12 2D 1H-15N HSQC

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

13 2D 1H-13C H(CN)CO

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

14 2D 1H-13C C(C)H-COSY

Instrument

Varian INOVA - 600 MHz

Sample

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.02 mM
2	phage GA operator RNA hairpin	[U-13C; U-15N]	1 (±0.1) mM
3	potassium chloride	natural abundance	10 mM
4	potassium phosphate	natural abundance	10 mM
5	D2O	natural abundance	100 %

NMR combined restraints 6 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints, RDC restraints	combined_30224_5uf3.nef
Input source #2: Coordindates	5uf3.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

--------10--------20---
GGACAUAAGGAAAACCUAUGUCC
|||||||||||||||||||||||
GGACAUAAGGAAAACCUAUGUCC

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	23	0	0	100.0

Content subtype: combined_30224_5uf3.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	OK	424		100.0 (chain: A, length: 23)
1	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	325 (1)	noe	95.7 (chain: A, length: 23)
2	Distance restraints	CNS/XPLOR_distance_constraints_6	OK	46 (1)	hbond	78.3 (chain: A, length: 23)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_3	OK	205 (205)	.	100.0 (chain: A, length: 23)
1	RDC restraints	CNS/XPLOR_dipolar_coupling_5	OK	46 (46)	.	82.6 (chain: A, length: 23)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: OK
Sequence coverage of experimental data
- Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
Total number of assignments
- ¹H chemical shifts: 196
- ¹³C chemical shifts: 158
- ¹⁵N chemical shifts: 49
- ³¹P chemical shifts: 21

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
1	G	N9	166.32
1	G	P	-3.46
2	G	N7	234.69
2	G	N9	169.67
2	G	P	-3.99
3	A	H62	7.9
3	A	H61	6.98
3	A	N1	223.55
3	A	N3	212.57
3	A	N7	230.23
3	A	N9	171.31
3	A	P	-3.97
4	C	C2	158.41
4	C	C4	168.18
4	C	N1	148.12
4	C	N4	95.35
4	C	P	-3.96
5	A	H62	7.78
5	A	H61	6.47
5	A	N1	222.36
5	A	N3	214.65
5	A	N7	231.42
5	A	N9	171.01
5	A	P	-4.28
6	U	C2	152.16
6	U	C4	168.71
6	U	N1	142.95
6	U	P	-3.83
7	A	N7	232.61
7	A	N9	169.97
7	A	P	-3.64
8	A	P	-3.71
9	G	P	-3.88
10	G	P	-3.47
11	A	P	-3.74
12	A	N7	232.31
12	A	N9	168.63
12	A	P	-3.79
13	A	N1	225.78
13	A	N3	217.32
13	A	N7	230.98
13	A	N9	169.38
13	A	P	-3.76
14	A	H62	8.4
14	A	H61	7.14
14	A	N1	226.08
14	A	N3	217.61
14	A	N7	233.2
14	A	N9	170.27
14	A	P	-3.21
15	C	C2	158.8
15	C	C4	168.66
15	C	N1	151.59
15	C	N4	95.26
15	C	P	-4.38
16	C	N1	150.12
16	C	N4	95.26
17	U	C4	169.24
17	U	N1	143.87
17	U	P	-3.81
18	A	H62	7.67
18	A	H61	6.56
18	A	N1	223.26
18	A	N3	214.05
18	A	N7	231.12
18	A	N9	171.46
18	A	P	-4.29
19	U	C2	152.16
19	U	C4	168.76
19	U	N1	142.56
19	U	P	-3.94
20	G	N7	235.87
20	G	N9	169.67
20	G	P	-4.57
21	U	C2	152.65
21	U	C4	168.42
21	U	P	-4.26
22	C	C2	158.6
22	C	C4	168.27
22	C	N1	149.81
22	C	N4	95.65
22	C	P	-4.17
23	C	C2	159.7
23	C	C4	168.71
23	C	N1	150.5
23	C	N4	94.0

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	198	188	94.9
¹³C chemical shifts	156	143	91.7
¹⁵N chemical shifts	9	7	77.8

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	138	132	95.7
¹³C chemical shifts	115	105	91.3

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	60	56	93.3
¹³C chemical shifts	41	38	92.7
¹⁵N chemical shifts	9	7	77.8

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	23	22	95.7
¹³C chemical shifts	23	20	87.0

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_4
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 95.7%
- Total number of restraints: 325
- Weight of restraints: 1.0 (325)
- Potential type of restraints: square-well-parabolic (325)
- Range of distance target values: 2.15, 4.15 (Å)
- Histogram of distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_6
  - Status: OK
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 78.3%
  - Total number of restraints: 46
  - Weight of restraints: 1.0 (46)
  - Potential type of restraints: square-well-parabolic (46)
  - Range of distance target values: 2.0, 3.0 (Å)
  - Histogram of distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_3
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 100.0%
- Total number of restraints: 205
- Total number of restraints per polymer type: 205
- Weight of restraints: 1.0 (205)
- Potential type of restraints: square-well-parabolic (205)
- Dihedral angle restraints per residue
  - Chain_ID: A

RDC restraints

Saveframe: CNS/XPLOR_dipolar_coupling_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 23, Sequence coverage: 82.6%
- Total number of restraints: 46
- Potential type of restraints: square-well-parabolic (46)
- Range of observed RDC values: -17.3, 16.4 (Hz)
- Histogram of observed RDC values
- RDC restraints per residue
  - Chain_ID: A
    None

Keywords (A-A)-U motif, RNA hairpin, phage, tetraloop

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.549 seconds)

BMRB: 30224

Sample #1

Sample #2

Sample #3

Sample #4

Sample #5

Sample #6

Experiments performed 14 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 6 contents Detail