BMRBj - BMREntryMaster

Found 1 Document (0.418 seconds)

BMRB: 30257

5UZT

Structure of wild type pre-miR21 apical loop

Authors

Shortridge, M.D., Varani, G.

Assembly

pre-miR-21

Entity

1. pre-miR-21 (polymer, Thiol state: not present), 31 monomers, 9975.865 Da Detail

GGUGUUGACU GUUGAAUCUC AUGGCAACAC C

Formula weight

9975.865 Da

Source organism

Homo sapiens

Exptl. method

solution NMR

Data set

assigned_chemical_shifts

Chem. Shift Complete

Sequence coverage: 100.0 %, Completeness: 56.3 %, Completeness (bb): 47.2 % Detail

Polymer type: polyribonucleotide

	Total	¹H	¹³C
All	56.3 % (270 of 480)	52.0 % (141 of 271)	61.7 % (129 of 209)
Suger, PO4	47.2 % (161 of 341)	40.3 % (75 of 186)	55.5 % (86 of 155)
Nucleobase	78.4 % (109 of 139)	77.6 % (66 of 85)	79.6 % (43 of 54)
Aromatic	82.4 % (103 of 125)	84.5 % (60 of 71)	79.6 % (43 of 54)

1. entity 1

GGUGUUGACU GUUGAAUCUC AUGGCAACAC C

Show sample condition

Sample #1

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.01 mM
2	potassium phosphate	natural abundance	10 mM
3	pre-miR-21	natural abundance	1.1 mM
4	sodium chloride	natural abundance	10 mM

Sample #2

Solvent system 100% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
5	EDTA	natural abundance	0.01 mM
6	potassium phosphate	natural abundance	10 mM
7	pre-miR-21	natural abundance	1.1 mM
8	sodium chloride	natural abundance	10 mM

Sample #3

Solvent system 100% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
9	EDTA	natural abundance	0.01 mM
10	potassium phosphate	natural abundance	10 mM
11	pre-miR-21	[U-99% 13C; U-99% 15N]	0.5 mM
12	sodium chloride	natural abundance	10 mM

Sample #4

Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 g/L EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
13	EDTA	natural abundance	0.01 g/L
14	potassium phosphate	natural abundance	10 mM
15	pre-miR-21	[U-99% 13C; U-99% 15N]	0.5 mM
16	sodium chloride	natural abundance	10 mM

Release date

2017-05-01

Citation

A Macrocyclic Peptide Ligand Binds the Oncogenic MicroRNA-21 Precursor and Suppresses Dicer Processing
Shortridge, M.D., Walker, M.J., Pavelitz, T., Chen, Y., Yang, W., Varani, G.
ACS Chem. Biol. (2017), 12, 1611-1620, PubMed 28437065 , DOI 10.1021/acschembio.7b00180 , Abstract

Related entities 1. pre-miR-21, : 1 : 1 : 1 entities Detail

Experiments performed 6 experiments Detail

1 2D 1H-1H NOESY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
1	EDTA	natural abundance	0.01 mM
2	potassium phosphate	natural abundance	10 mM
3	pre-miR-21	natural abundance	1.1 mM
4	sodium chloride	natural abundance	10 mM

2 3D 1H-13C NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.5, Details 0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
9	EDTA	natural abundance	0.01 mM
10	potassium phosphate	natural abundance	10 mM
11	pre-miR-21	[U-99% 13C; U-99% 15N]	0.5 mM
12	sodium chloride	natural abundance	10 mM

3 2D 1H-1H TOCSY

Instrument

Bruker DRX - 500 MHz

Sample

State isotropic, Solvent system 100% D2O, Pressure 1 atm, Temperature 310 K, pH 6.5, Details 1.1 mM pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 mM EDTA, 100% D2O.

#	Name	Isotope labeling	Concentration
5	EDTA	natural abundance	0.01 mM
6	potassium phosphate	natural abundance	10 mM
7	pre-miR-21	natural abundance	1.1 mM
8	sodium chloride	natural abundance	10 mM

4 2D 1H-15N HSQC

Instrument

Bruker AvanceIII - 800 MHz

Sample

State isotropic, Solvent system 95% H2O/5% D2O, Pressure 1 atm, Temperature 278 K, pH 6.5, Details 0.5 mM [U-99% 13C; U-99% 15N] pre-miR-21, 10 mM potassium phosphate, 10 mM sodium chloride, 0.01 g/L EDTA, 95% H2O/5% D2O.

#	Name	Isotope labeling	Concentration
13	EDTA	natural abundance	0.01 g/L
14	potassium phosphate	natural abundance	10 mM
15	pre-miR-21	[U-99% 13C; U-99% 15N]	0.5 mM
16	sodium chloride	natural abundance	10 mM

5 3D 1H-15N NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
13	EDTA	natural abundance	0.01 g/L
14	potassium phosphate	natural abundance	10 mM
15	pre-miR-21	[U-99% 13C; U-99% 15N]	0.5 mM
16	sodium chloride	natural abundance	10 mM

6 2D 1H-1H NOESY

Instrument

Bruker AvanceIII - 800 MHz

Sample

#	Name	Isotope labeling	Concentration
5	EDTA	natural abundance	0.01 mM
6	potassium phosphate	natural abundance	10 mM
7	pre-miR-21	natural abundance	1.1 mM
8	sodium chloride	natural abundance	10 mM

NMR combined restraints 5 contents Detail

Properties

Input source #1: NMR data (NEF) - Assigned chemical shifts, Distance restraints, Dihedral angle restraints	combined_30257_5uzt.nef
Input source #2: Coordindates	5uzt.cif
Diamagnetism of the molecular assembly	True (excluding Oxygen atoms)
Whether the assembly has a disulfide bond	None
Whether the assembly has a other bond	None
Whether the assembly contains a cyclic polymer	None
Overall data processing status	Warning

Disulfide bonds

None

Other bonds (neither disulfide, covalent nor hydrogen bonds, e.g. Zinc–sulphur bond)

None

Non-standard residues

None

Sequence alignments

Entity_assembly_ID (NMR): A vs Auth_asym_ID (model): A

-------30--------40--------50--
GGUGUUGACUGUUGAAUCUCAUGGCAACACC
|||||||||||||||||||||||||||||||
GGUGUUGACUGUUGAAUCUCAUGGCAACACC
--------10--------20--------30-

Chain assignments

Entity_assembly_ID (NMR)	Auth_asym_ID (model)	Length	Unmapped	Conflict	Sequence coverage (%)
A	A	31	0	0	100.0

Content subtype: combined_30257_5uzt.nef

#	Content subtype	Saveframe	Status	# of rows (sets)	Experiment type	Sequence coverage (%)
1	Assigned chemical shifts	assigned_chemical_shifts_1	Warning	309		100.0 (chain: A, length: 31)
1	Distance restraints	CNS/XPLOR_distance_constraints_4	OK	347 (1)	noe	100.0 (chain: A, length: 31)
2	Distance restraints	CNS/XPLOR_distance_constraints_3	Warning	39 (1)	hbond	51.6 (chain: A, length: 31)
1	Dihedral angle restraints	CNS/XPLOR_dihedral_5	OK	131 (131)	.	61.3 (chain: A, length: 31)

Assigned chemical shifts

Saveframe: assigned_chemical_shifts_1

Status: Warning

Sequence coverage of experimental data

Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 100.0%

-------30--------40--------50--
GGUGUUGACUGUUGAAUCUCAUGGCAACACC
|||||||||||||||||||||||||||||||
GGUGUUGACUGUUGAAUCUCAUGGCAACACC

Total number of assignments
- ¹H chemical shifts: 180
- ¹³C chemical shifts: 129

Completeness of assignments

Entity_assemble_ID: A

Excluded Atom_ID in statistics

Comp_index_ID	Comp_ID	Atom_ID	CS value (ppm)
22	G	HO2'	4.95
23	G	H21	6.33
23	G	HO2'	4.49
24	U	HO2'	4.69
25	G	H21	6.51
25	G	HO2'	4.46
26	U	HO2'	4.43
27	U	HO2'	4.52
28	G	H22	7.22
28	G	H21	5.96
28	G	HO2'	4.41
29	A	H62	10.4
29	A	H61	9.08
29	A	HO2'	4.6
31	U	HO2'	4.41
32	G	HO2'	4.54
33	U	HO2'	4.26
34	U	HO2'	4.505
35	G	HO2'	4.66
36	A	HO2'	4.64
37	A	HO2'	4.29
38	U	HO2'	4.55
39	C	HO2'	4.34
40	U	HO2'	4.4
41	C	HO2'	4.67
44	G	HO2'	4.67
45	G	HO2'	4.53
47	A	H62	7.82
47	A	H61	6.43
47	A	HO2'	4.47
48	A	H62	8.03
48	A	H61	6.7
48	A	HO2'	4.32
49	C	HO2'	4.19
50	A	H62	8.06
50	A	H61	6.36
50	A	HO2'	4.49
51	C	HO2'	4.1
52	C	HO2'	3.97

All atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	271	141	52.0
¹³C chemical shifts	209	129	61.7

Backbone atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	186	75	40.3
¹³C chemical shifts	155	86	55.5

Side chain atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	85	66	77.6
¹³C chemical shifts	54	43	79.6

Methyl group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)

Aromatic group atoms

Atom group	# of target shifts	# of assigned shifts	Completeness (%)
¹H chemical shifts	22	22	100.0
¹³C chemical shifts	22	17	77.3

Histogram of normalized assigned chemical shifts

Distance restraints

Saveframe: CNS/XPLOR_distance_constraints_4
- Status: OK
- Experiment type: noe
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 100.0%
- Total number of restraints: 347
- Weight of restraints: 1.0 (347)
- Potential type of restraints: square-well-parabolic (347)
- Range of distance target values: 2.5, 5.5 (Å)
- Histogram of distance target values
- Histogram of discrepancy in distance target values
- Distance restraints per residue
  - Chain_ID: A
- Distance restraints on contact map
- Saveframe: CNS/XPLOR_distance_constraints_3
  - Status: Warning
  - Experiment type: hbond
  - Sequence coverage of experimental data
    - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 51.6%
  - Total number of restraints: 39
  - Weight of restraints: 1.0 (39)
  - Potential type of restraints: square-well-parabolic (39)
  - Range of distance target values: 1.73, 3.63 (Å)
  - Histogram of distance target values
  - Histogram of discrepancy in distance target values
  - Distance restraints per residue
    - Chain_ID: A
  - Distance restraints on contact map

Dihedral angle restraints

Saveframe: CNS/XPLOR_dihedral_5
- Status: OK
- Experiment type: .
- Sequence coverage of experimental data
  - Entity_assembly_ID: A, Chain length: 31, Sequence coverage: 61.3%
- Total number of restraints: 131
- Total number of restraints per polymer type: 131
- Weight of restraints: 1.0 (131)
- Potential type of restraints: square-well-parabolic (131)
- Dihedral angle restraints per residue
  - Chain_ID: A

Keywords RNA, microRNA miR-21 oncomiR pre-miRNA

Search

Query history

Resources

Search for primary databases

Search for subsidiary databases

Display

Hits per page

Statistics

Query Changes will take effect after "OK" button is selected.

Maximum hits

Default conjunction operator

Omni-box

Search filter

Sequence search (BLAST)

E-value

Query sequence coverage

Miscellaneous

The number of previewed publications

Completeness of assigned chemical shift

Sequence chart about top aligned regions

Sequence chart about interacting regions

Hit context with highlight

Link destinations for BMRB, PDB and EMDB

Found 1 Document (0.418 seconds)

BMRB: 30257

Sample #1

Sample #2

Sample #3

Sample #4

Related entities 1. pre-miR-21, : 1 : 1 : 1 entities Detail

Experiments performed 6 experiments Detail

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

Instrument

Sample

NMR combined restraints 5 contents Detail